Rmu_sc0000459.1_g000023

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000459.1
Physical Location & Seq
Reverse (-)
104293 .. 104718
426 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000459.1_g000023.1.cds

Sequence Viewer

Length: 426 bp
atggagattgctccgactacgtgctacgaaaacttgaagaggtactggaggaggagaaggtaccagagactgaatggtgacaagaagaagaagatgagggtcgtaaggctcggtggtggacctaatgggagcactagtcctactcggcggtcttggaagatcagaactgcagcgaagcttagactgatcaagtttgtttcgccgataaagctgttggccaagctccacggtgcttatgttgacatgatggttcggacggcaggcaacgttggcggcgctaggaggattgcaggaggatcaaagaaggtggcaaaagcgcaagatcagctttcggtggcggcttccgaggaagctgttgacaccagattggttttggagatttacaagagactcgctgcttctcgccaattagcagatgtctactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

141

Amino Acids

15.88

Weight (kDa)

11.03

Isoelectric Point (pI)

45.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 60
AccB1I GGYRCC 1 cut(s) 60
AccI GTMKAC 1 cut(s) 420
AciI CCGC 3 cut(s) 148, 273, 338
AclI AACGTT 1 cut(s) 267
AclWI GGATC 1 cut(s) 304
AcoI YGGCCR 1 cut(s) 216
AfaI GTAC 2 cut(s) 44, 62
AgsI TTSAA 1 cut(s) 37
AhlI ACTAGT 1 cut(s) 134
AluBI AGCT 5 cut(s) 178, 211, 223, 328, 353
AluI AGCT 5 cut(s) 178, 211, 223, 328, 353
Alw21I GWGCWC 1 cut(s) 134
Alw26I GTCTC 2 cut(s) 61, 382
AlwI GGATC 1 cut(s) 304
AlwNI CAGNNNCTG 1 cut(s) 70
AoxI GGCC 1 cut(s) 216
ApeKI GCWGC 2 cut(s) 170, 395
Asp718I GGTACC 1 cut(s) 60
AspLEI GCGC 2 cut(s) 278, 319
AspS9I GGNCC 1 cut(s) 119
AsuHPI GGTGA 1 cut(s) 89
AvaII GGWCC 1 cut(s) 119
BalI TGGCCA 1 cut(s) 218
BanI GGYRCC 1 cut(s) 60
Bbv12I GWGCWC 1 cut(s) 134
BbvI GCAGC 2 cut(s) 182, 382
BccI CCATC 1 cut(s) 241
BceAI ACGGC 1 cut(s) 273
BclI TGATCA 1 cut(s) 186
BcoDI GTCTC 2 cut(s) 61, 382
BcuI ACTAGT 1 cut(s) 134
BfaI CTAG 2 cut(s) 135, 279
BfmI CTRYAG 1 cut(s) 168
BfoI RGCGCY 1 cut(s) 279
BisI GCNGC 4 cut(s) 171, 274, 339, 396
BlsI GCNGC 4 cut(s) 172, 275, 340, 397
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 119
BmiI GGNNCC 1 cut(s) 62
BpmI CTGGAG 1 cut(s) 67
BsaAI YACGTR 1 cut(s) 21
BsaJI CCNNGG 2 cut(s) 226, 345
BsaXI ACNNNNNCTCC 2 cut(s) 121, 151
Bse1I ACTGG 1 cut(s) 50
BseDI CCNNGG 2 cut(s) 226, 345
BseNI ACTGG 1 cut(s) 50
BseRI GAGGAG 2 cut(s) 64, 67
BseXI GCAGC 2 cut(s) 182, 382
BshFI GGCC 1 cut(s) 218
BshNI GGYRCC 1 cut(s) 60
BsiHKAI GWGCWC 1 cut(s) 134
BsmAI GTCTC 2 cut(s) 61, 382
BsnI GGCC 1 cut(s) 218
Bsp1286I GDGCHC 1 cut(s) 134
Bsp143I GATC 4 cut(s) 159, 186, 296, 322
BspACI CCGC 3 cut(s) 148, 273, 338
BspANI GGCC 1 cut(s) 218
BspLI GGNNCC 1 cut(s) 62
BspMAI CTGCAG 1 cut(s) 172
BspPI GGATC 1 cut(s) 304
BspT107I GGYRCC 1 cut(s) 60
BsrI ACTGG 1 cut(s) 50
BssECI CCNNGG 2 cut(s) 226, 345
BssMI GATC 4 cut(s) 159, 186, 296, 322
Bst4CI ACNGT 1 cut(s) 230
Bst6I CTCTTC 1 cut(s) 32
BstBAI YACGTR 1 cut(s) 21
BstC8I GCNNGC 1 cut(s) 262
BstDEI CTNAG 1 cut(s) 179
BstDSI CCRYGG 1 cut(s) 226
BstH2I RGCGCY 1 cut(s) 279
BstHHI GCGC 2 cut(s) 278, 319
BstKTI GATC 4 cut(s) 162, 189, 299, 325
BstMAI GTCTC 2 cut(s) 61, 382
BstMBI GATC 4 cut(s) 159, 186, 296, 322
BstMWI GCNNNNNNNGC 3 cut(s) 208, 270, 325
BstSFI CTRYAG 1 cut(s) 168
BstV1I GCAGC 2 cut(s) 182, 382
BsuRI GGCC 1 cut(s) 218
BtgI CCRYGG 1 cut(s) 226
Cac8I GCNNGC 1 cut(s) 262
CaiI CAGNNNCTG 1 cut(s) 70
CfoI GCGC 2 cut(s) 278, 319
Cfr13I GGNCC 1 cut(s) 119
Csp6I GTAC 2 cut(s) 43, 61
CspCI CAANNNNNGTGG 2 cut(s) 288, 323
CviAII CATG 1 cut(s) 244
CviJI RGCY 8 cut(s) 109, 178, 211, 218, 223, 328, 341, 353
CviKI_1 RGCY 8 cut(s) 109, 178, 211, 218, 223, 328, 341, 353
CviQI GTAC 2 cut(s) 43, 61
DdeI CTNAG 1 cut(s) 179
DpnI GATC 4 cut(s) 161, 188, 298, 324
DpnII GATC 4 cut(s) 159, 186, 296, 322
EaeI YGGCCR 1 cut(s) 216
Eam1104I CTCTTC 1 cut(s) 32
EarI CTCTTC 1 cut(s) 32
Eco47I GGWCC 1 cut(s) 119
FaeI CATG 1 cut(s) 247
FaiI YATR 2 cut(s) 237, 245
FalI AAGNNNNNCTT 2 cut(s) 312, 344
FatI CATG 1 cut(s) 243
FbaI TGATCA 1 cut(s) 186
FblI GTMKAC 1 cut(s) 420
Fnu4HI GCNGC 4 cut(s) 171, 274, 339, 396
Fsp4HI GCNGC 4 cut(s) 171, 274, 339, 396
FspBI CTAG 2 cut(s) 135, 279
GlaI GCGC 2 cut(s) 277, 318
GluI GCNGC 4 cut(s) 171, 274, 339, 396
GsuI CTGGAG 1 cut(s) 67
HaeII RGCGCY 1 cut(s) 279
HaeIII GGCC 1 cut(s) 218
HhaI GCGC 2 cut(s) 278, 319
Hin1II CATG 1 cut(s) 247
Hin6I GCGC 2 cut(s) 276, 317
HinP1I GCGC 2 cut(s) 276, 317
HincII GTYRAC 2 cut(s) 241, 358
HindII GTYRAC 2 cut(s) 241, 358
HindIII AAGCTT 1 cut(s) 176
HinfI GANTC 1 cut(s) 390
HphI GGTGA 1 cut(s) 89
Hpy166II GTNNAC 4 cut(s) 119, 241, 358, 421
Hpy188I TCNGA 4 cut(s) 15, 164, 255, 346
Hpy8I GTNNAC 4 cut(s) 119, 241, 358, 421
HpyAV CCTTC 2 cut(s) 51, 298
HpyCH4III ACNGT 1 cut(s) 230
HpyCH4IV ACGT 2 cut(s) 20, 267
HpyCH4V TGCA 2 cut(s) 170, 290
HpyF10VI GCNNNNNNNGC 3 cut(s) 208, 270, 325
HpyF3I CTNAG 1 cut(s) 179
HpySE526I ACGT 2 cut(s) 20, 267
Hsp92II CATG 1 cut(s) 247
HspAI GCGC 2 cut(s) 276, 317
KpnI GGTACC 1 cut(s) 64
Ksp22I TGATCA 1 cut(s) 186
Kzo9I GATC 4 cut(s) 159, 186, 296, 322
LmnI GCTCC 3 cut(s) 16, 129, 228
LpnPI CCDG 5 cut(s) 31, 77, 246, 276, 376
Lsp1109I GCAGC 2 cut(s) 182, 382
MaeI CTAG 2 cut(s) 135, 279
MaeII ACGT 2 cut(s) 20, 267
MaeIII GTNAC 1 cut(s) 77
MalI GATC 4 cut(s) 161, 188, 298, 324
MboI GATC 4 cut(s) 159, 186, 296, 322
MboII GAAGA 5 cut(s) 49, 97, 100, 103, 169
MhlI GDGCHC 1 cut(s) 134
MlsI TGGCCA 1 cut(s) 218
MluCI AATT 1 cut(s) 407
MluNI TGGCCA 1 cut(s) 218
MlyI GAGTC 1 cut(s) 384
MmeI TCCRAC 1 cut(s) 38
MnlI CCTC 7 cut(s) 33, 42, 45, 90, 276, 287, 340
Mox20I TGGCCA 1 cut(s) 218
MscI TGGCCA 1 cut(s) 218
Msp20I TGGCCA 1 cut(s) 218
MwoI GCNNNNNNNGC 3 cut(s) 208, 270, 325
NdeII GATC 4 cut(s) 159, 186, 296, 322
NlaIII CATG 1 cut(s) 247
NlaIV GGNNCC 1 cut(s) 62
NmeAIII GCCGAG 1 cut(s) 124
NmuCI GTSAC 1 cut(s) 77
PkrI GCNGC 4 cut(s) 172, 275, 340, 397
PleI GAGTC 1 cut(s) 384
PpsI GAGTC 1 cut(s) 384
Ppu21I YACGTR 1 cut(s) 21
Psp1406I AACGTT 1 cut(s) 267
PspN4I GGNNCC 1 cut(s) 62
PspPI GGNCC 1 cut(s) 119
PstI CTGCAG 1 cut(s) 172
PstNI CAGNNNCTG 1 cut(s) 70
RsaI GTAC 2 cut(s) 44, 62
RsaNI GTAC 2 cut(s) 43, 61
SatI GCNGC 4 cut(s) 171, 274, 339, 396
Sau3AI GATC 4 cut(s) 159, 186, 296, 322
Sau96I GGNCC 1 cut(s) 119
SchI GAGTC 1 cut(s) 384
SduI GDGCHC 1 cut(s) 134
SfcI CTRYAG 1 cut(s) 168
SinI GGWCC 1 cut(s) 119
SpeI ACTAGT 1 cut(s) 134
Sse9I AATT 1 cut(s) 407
SsiI CCGC 3 cut(s) 148, 273, 338
SspMI CTAG 2 cut(s) 135, 279
TaaI ACNGT 1 cut(s) 230
TaiI ACGT 2 cut(s) 23, 270
TasI AATT 1 cut(s) 407
TauI GCSGC 2 cut(s) 276, 341
TseFI GTSAC 1 cut(s) 77
TseI GCWGC 2 cut(s) 170, 395
Tsp45I GTSAC 1 cut(s) 77
VpaK11BI GGWCC 1 cut(s) 119
XcmI CCANNNNNNNNNTGG 2 cut(s) 71, 370
XmiI GTMKAC 1 cut(s) 420
XspI CTAG 2 cut(s) 135, 279
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.