Rh4AG330800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
64102055 .. 64102246
192 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG330800.1

Sequence Viewer

Length: 192 bp
ATGGAGATTGCTCCCACTACATGCTACGAAAACTTGAAGAGGTACTGGAGAAGGAAAAGGTACCAAAGATTGTATGGAGACTGCAGCAAGAAGAAGATGAGGGTTGCAAGTCTCGGTGGTGGAGCTAATGGGAGTACTAGTCCTACTCGGTTTTTCAAGATCAGAAAGCTTCAATTGATCAAGTTTGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.45

Weight (kDa)

10.63

Isoelectric Point (pI)

37.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 60
AccB1I GGYRCC 1 cut(s) 60
AfaI GTAC 3 cut(s) 44, 62, 136
AgsI TTSAA 3 cut(s) 37, 157, 173
AhlI ACTAGT 1 cut(s) 137
AluBI AGCT 2 cut(s) 125, 169
AluI AGCT 2 cut(s) 125, 169
Alw26I GTCTC 2 cut(s) 72, 116
ApeKI GCWGC 1 cut(s) 84
Asp718I GGTACC 1 cut(s) 60
BanI GGYRCC 1 cut(s) 60
BbvI GCAGC 1 cut(s) 96
BclI TGATCA 1 cut(s) 177
BcoDI GTCTC 2 cut(s) 72, 116
BcuI ACTAGT 1 cut(s) 137
BfaI CTAG 1 cut(s) 138
BfmI CTRYAG 1 cut(s) 82
BisI GCNGC 1 cut(s) 85
BlsI GCNGC 1 cut(s) 86
BmcAI AGTACT 1 cut(s) 136
BmiI GGNNCC 1 cut(s) 62
BpmI CTGGAG 1 cut(s) 67
BsaXI ACNNNNNCTCC 2 cut(s) 124, 154
Bse1I ACTGG 1 cut(s) 50
BseNI ACTGG 1 cut(s) 50
BseXI GCAGC 1 cut(s) 96
BshNI GGYRCC 1 cut(s) 60
BsmAI GTCTC 2 cut(s) 72, 116
Bsp143I GATC 2 cut(s) 159, 177
BspLI GGNNCC 1 cut(s) 62
BspMAI CTGCAG 1 cut(s) 86
BspT107I GGYRCC 1 cut(s) 60
BsrI ACTGG 1 cut(s) 50
BssMI GATC 2 cut(s) 159, 177
Bst6I CTCTTC 1 cut(s) 32
BstKTI GATC 2 cut(s) 162, 180
BstMAI GTCTC 2 cut(s) 72, 116
BstMBI GATC 2 cut(s) 159, 177
BstNSI RCATGY 1 cut(s) 24
BstSFI CTRYAG 1 cut(s) 82
BstV1I GCAGC 1 cut(s) 96
Csp6I GTAC 3 cut(s) 43, 61, 135
CviAII CATG 1 cut(s) 21
CviJI RGCY 2 cut(s) 125, 169
CviKI_1 RGCY 2 cut(s) 125, 169
CviQI GTAC 3 cut(s) 43, 61, 135
DpnI GATC 2 cut(s) 161, 179
DpnII GATC 2 cut(s) 159, 177
Eam1104I CTCTTC 1 cut(s) 32
EarI CTCTTC 1 cut(s) 32
FaeI CATG 1 cut(s) 24
FaiI YATR 2 cut(s) 22, 75
FatI CATG 1 cut(s) 20
FbaI TGATCA 1 cut(s) 177
Fnu4HI GCNGC 1 cut(s) 85
Fsp4HI GCNGC 1 cut(s) 85
FspBI CTAG 1 cut(s) 138
GluI GCNGC 1 cut(s) 85
GsuI CTGGAG 1 cut(s) 67
Hin1II CATG 1 cut(s) 24
HindIII AAGCTT 1 cut(s) 167
Hpy188I TCNGA 1 cut(s) 164
Hpy188III TCNNGA 1 cut(s) 157
HpyAV CCTTC 1 cut(s) 45
HpyCH4V TGCA 2 cut(s) 84, 107
Hsp92II CATG 1 cut(s) 24
KpnI GGTACC 1 cut(s) 64
Ksp22I TGATCA 1 cut(s) 177
Kzo9I GATC 2 cut(s) 159, 177
LmnI GCTCC 2 cut(s) 16, 122
LpnPI CCDG 1 cut(s) 31
Lsp1109I GCAGC 1 cut(s) 96
MaeI CTAG 1 cut(s) 138
MalI GATC 2 cut(s) 161, 179
MboI GATC 2 cut(s) 159, 177
MboII GAAGA 3 cut(s) 49, 103, 106
MfeI CAATTG 1 cut(s) 173
MluCI AATT 1 cut(s) 173
MnlI CCTC 2 cut(s) 33, 93
MunI CAATTG 1 cut(s) 173
NdeII GATC 2 cut(s) 159, 177
NlaIII CATG 1 cut(s) 24
NlaIV GGNNCC 1 cut(s) 62
NspI RCATGY 1 cut(s) 24
PkrI GCNGC 1 cut(s) 86
PspN4I GGNNCC 1 cut(s) 62
PstI CTGCAG 1 cut(s) 86
RsaI GTAC 3 cut(s) 44, 62, 136
RsaNI GTAC 3 cut(s) 43, 61, 135
SatI GCNGC 1 cut(s) 85
Sau3AI GATC 2 cut(s) 159, 177
ScaI AGTACT 1 cut(s) 136
SetI ASST 4 cut(s) 44, 62, 127, 171
SfcI CTRYAG 1 cut(s) 82
SgeI CNNG 9 cut(s) 33, 46, 58, 100, 120, 125, 150, 159, 169
SpeI ACTAGT 1 cut(s) 137
Sse9I AATT 1 cut(s) 173
SspMI CTAG 1 cut(s) 138
TasI AATT 1 cut(s) 173
TatI WGTACW 1 cut(s) 134
TseI GCWGC 1 cut(s) 84
XceI RCATGY 1 cut(s) 24
XcmI CCANNNNNNNNNTGG 1 cut(s) 71
XspI CTAG 1 cut(s) 138
ZrmI AGTACT 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.