Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000540.1

Orthogroup ID

OG0001986

Physical Location & Seq

Genomic Coordinates Reverse (-)

115225 .. 129040

Gene Structure 13816 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000540.1_g000024.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 5847 bp

atgatagcggaaggataccaatttgaagcagttcgatcaaggttgaagctcctgcttcatttttcttcaccaagcatgtcggaagctcaaaggagattggtgacaactattagtcttcctcgtaataatggttacgtaaatgggggactatcaatcaggtcccctgctgcagcacctgcagttgaggagttttgctatgcccttggtgggaagaagccaatccatagcattttaatagcaaataatggaatggcagcagtcaagtttatacgtagtgtgaggacatgggcttatgaaacatttggtacagaaaaggctgttttgttggtggccatggccacaccagaagacatgagaatcaatgcagaacacattagaattgctgatcagtttgtggaagttcctggtggaactaacaataataactatgccaatgtgcaactcattgtagagatggcagagataacacatgttgatgcagtttggcctggttggggccatgcatctgagatccctgagcttccagatgcattgactgcaaagggcatcatatttctcgggccaccagctgtatctatggcagcattaggagataaaattggttcctcattaattgctcaagctgctgaagtacccacccttccatggagtggatcgcatgtgaaaattgcttcagacagctgcctggttacgatcgcagatgaaatatatcgggaagcatgtgtttacacaacagaggaagcgattgcaagttgtcaggttgttggttacccagccatgattaaggcatcatggggtggtggtggtaaaggcataagaaaggtccataatgatgatgaagttagggcattgttcaagcaagtccagggtgaagttcctggatctcccatattcataatgaaagtcgcatcccagagccgacatttagaagtccagttactatgtgatcagcatggaaatgttgcagctttgcacagccgtgattgcagtgttcaaaggaggcaccagaagattattgaggagggtccaataactgtagctccaccagagacaattaaaaagttggagcaggcggctcgaaggttggctaaaagtgttaactatgttggagcagctactgttgagtatctgtacagtatggacactggcgagtactatttcttagagttgaaccctcggttgcaggtggagcacccagtcactgagtggatagcagaaataaatctgccagcagcccaagttgcagttgggatgggcattcccctctggcaaattcctgagataaggcggttctatggaatggaacatggtagcggatatgatgcttggagaaagacgtcagttgttgccaccccatttgactttgacaaggcagaatctacaaggccaaaaggtcattgtgttgctgtgcgtgtaacaagtgaggatccagatgatggctttaaacctactagtgggaaagttcaggagctgagttttaaaagcaagccaaatgtttgggcgtacttttctgttaagtctggaggggggattcatgagtactcagattctcagtttggacatgtttttgcatttggagagtctcgagctctagctattgcaaatatggttcttgggctgaaggaaattcaaattcgaggagaaattcgtacaaatgtggattattcaatagatcttttacatgcttcagattacagagaaaataaaatccacacaggttggttggatagtagaattgctatgcgggttagaacagaaaggcctccttggtatttgtctgtaattggagggactctttttaaagcatctgctagtagtgcggcgatggtttcagattatattggctatcttgagaaagggcaaatcccacctaagcatatatcatttgtccattcacaagtgtctttgaacattgaggggagcaaatacacgattgacttggtgagagggggtcctgggaattatagattgcggatgaatgagtcagaggttgaagcagagatacatactttacgtgatggaggattactgatgcagttggatggaaacagtcacattatatatgcagaggaagaagcagctggaactcgtcttcttattgatggaaggacttgcttgcttcagaacgatcatgatccatccaagttaatagcagagacaccatgcaagctgttgaggttcttggttgctgatgatagtcatctcgatgctgatacaccatatgcagaggttgaggttatgaagatgtgtatgcctctactttcacctgcttctggagttatccactttcaattgtctgaaggccaagcaatgcaggctggtgaacttattgcaaggcttgatttagatgatccttcagctgtgagaaagacagaacctttccatggaaacttccccgtcctggggcctccaaccgcaatttctggtaaagttcatcaaagatgtgctgcaagcttaaacgcagcccgaatgattcttgctggttatgagcataacattgatgaagtagtgcaaaacttgctcaattgcctagatagtcctgaactccctttccttcaatggcaagaatgcttggctgttttggcaacccgcctacccaagaatctcaaaaatgaactggaatcaaaatttaaggattttgagttgatttctagctctcagaatgttgatttccctgccaaattgttgcgtggtgttcttgaggcccatctatcctcctgtcctgataaagaaaaaggagcccaagaaaggcttgttgaacctttgatgagccttgtgacgtcttatgaaggtggaagagaaagtcatgcccgagttattgttcaatccctctttgaagagtatctgtcagttgaagaattattcagtgacaacattcaggctgatgtgattgagcgccttcgacttcaatataagaaggatctgttgaaggttgtggaaattgtgctctctcatcaggctgatgtgattgagcgccttcgacttcaatataagaaggatctgttgaaggttgtggaaattgtgctctctcatcagggtgtaaagaataaaaataagttgattccacgactcatggaacaactggtgtaccccaaccctgctgcatacagggagaagctaattcggttttctcaacttaaccatacaaactattctcagttggcactaaaagcaagtcagcttatggagcaaaccaagttgagtgaacttcgttctagcattgctagaagtctttctgagttggagatgtttactgaggatggtgaaaccatggatactccaaagaggaaaagtgccataaatgaacgaatggaggatcttgtgagtgcacctttggcagttgaagatgcccttgtaggtctctttgatcatggtgatcacacccttcagaggcgggttgttgagagttatgtacgccggttataccagccctaccttgtaaaggggagtgtcaggatgcagtggcacagatctggtctaatagcttcatgggagttctcggaagaacctgttgagaggaaacatgagattgaaggtcaatcagttgataaaacattcctccagaaacacgaggagaggaaatggggagtcatggttataataaaatctcttcagtttcttccagcagttattagtggtgcactgaaggaaatgtctcataaccttcatgaagcaactccaaatggatctactgaaccaagtggctttggtaatatgatgcatattgctttggttggcatcaacaatcagatgagtctacttcaggatagtggtgatgaggatcaggctcaagaaagaattaagaagttagccaaaatacttaaagagcaaggagtagcctccagtctacacagtgcaggtgtcacagtaattagttgtatcatccaaagggatgaagggcgggcccctatgaggcactccttccactggtcatcagagaagctctattatgaagaagaacccctattgcgtcacctagagcctcctctatctatttaccttgaattggacaagcttaaaggctatgagaatatacagtataccccatctcgtgaccgtcaatggcacttgtacaccgttgtagacaagccactaccaatccaaaggatgttcctcagaacacttgtcaggcagcccacaacaaatgaagggagcatcttgaggtccttatcaacagcaatggaagagttggaactgaatgcgcacaatgccactgtcaaatctgatcacacccatatgtatctttatatcttacgtgagcaacaaattaatgatctgctgccttaccacaagagagttgatttagatgctcaacaagaagaaactgttgtggaggccatcttggacgaacttgcacgtgaaatccacacatcagttggtgtaaggatgcataggttgggtgtttgtgagtgggaagtgaagttgtggatggcatcctctggagaggcaaacattgcttggagggttgtcgtgacaaatgtgactgctgatgatcttgaaggaatatctgctattctaaagtggcttagctatgttcctccccatgttggtggcccactccccatttcaattcccttggatcctccagaaaggcgtgtggagtaccgcccggagaattcatgtgatcctcgtgctgcgatttctggtgctctgaatggtaatgggaactggatggggggtatattcgacaaagacagctttgttgagacgctagaaggctgggcaaggaccgttgttactggaagggcgaagcttggaggaatccctgtgggaattgttgctgttgagacacagacggtgacgcaaattattcctgctgatccaggccagcttgattctcatgagagggttgttcctcaggctggacaagtatggtttcctgattctgcaactaagactgcccaagcattattagatttcaacagagaaggactcccacttttcattcttgccaactggagaggcttttctggtgggcagagagaccttttcgaagggatccttcaggctggatcaaccattgtggagaacctaaggacttacaaacagcccgtttttgtattcatcccaatgatgggtgagctccgcggtggagcatgggtggtcgttgatagccggataaatccggaccatattgaaatgtatgctgatcgaacggctagaggaaatgtgcttgagccagaggggatgatcgagatcaagtttaggaacaaggaattgctggagtgcatgggcaggcttgaccaacagctgatccaactaaagactaagcttcaggaagccaggagctgtggggcgaatgagaaggttgaatccctacagtttcagatacgatcccgagaaaaacagcttttgcccgtctacactcagatagctaccaaatttgcagaacttcatgatacgtctctgaggatggctgcaaaaggggtaatcagaggagttttggagtgggccagctctcgatctttcttctacaagagattgcgtcggagaattgccgatgactcgctcatcaagatagtgagagatgctgctggtgaacagctgtcacatagatctgcaatcgatttgatcaagagctggtttttgagttctgatatttcaagaggcagggaaaatgcttgggaggatgatgaaaccttctttagatggaaggacgatcaaactaattatgagggtaagctaaaagaattgcgggtccagaaggtattgcttcaattggcaaccattggcaactcagcatctgatttgcaagccctacctcaaggtcttgctgcccttctaagcaaggttgagccatcaagcagatcatttttggttgaggaactccggaaggtgcttggttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003824 GO:0003989 GO:0005575 GO:0005623 GO:0005886 GO:0006082 GO:0006629 GO:0006631 GO:0006633 GO:0007275 GO:0008150 GO:0008152 GO:0008610 GO:0009058 GO:0009653 GO:0009719 GO:0009725 GO:0009735 GO:0009790 GO:0009791 GO:0009793 GO:0009888 GO:0009933 GO:0009987 GO:0010014 GO:0010016 GO:0010033 GO:0010072 GO:0010154 GO:0016020 GO:0016053 GO:0016421 GO:0016874 GO:0016885 GO:0019752 GO:0022414 GO:0022622 GO:0030497 GO:0032501 GO:0032502 GO:0032787 GO:0042221 GO:0043436 GO:0044237 GO:0044238 GO:0044249 GO:0044255 GO:0044281 GO:0044283 GO:0044464 GO:0046394 GO:0048316 GO:0048364 GO:0048367 GO:0048507 GO:0048508 GO:0048532 GO:0048608 GO:0048731 GO:0048856 GO:0050896 GO:0061458 GO:0071704 GO:0071944 GO:0072330 GO:0090421 GO:0099402 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00061 ko00254 ko00620 ko00640 ko01100 ko01110 ko01212 ko04152 ko04910 ko04922 map00061 map00254 map00620 map00640 map01100 map01110 map01212 map04152 map04910 map04922

Pfam Domains

Protein Families

ACC_central Biotin_carb_C Biotin_carb_N Biotin_lipoyl CPSase_L_D2 Carboxyl_trans

Protein Analysis

1948

Amino Acids

218.11

Weight (kDa)

5.98

Isoelectric Point (pI)

44.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001986)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G36160 AT1G36160 AT1G36180 AT1G36180 AT1G36180
fragaria_vesca	FvH4_5g38000 FvH4_5g38000 FvH4_5g38000 FvH4_5g38000 FvH4_5g38000 FvH4_5g38000
malus_domestica	MD08G1178000.v1.1 MD15G1363500.v1.1
prunus_persica	Prupe.1G512000_v2.0.a1 Prupe.1G512000_v2.0.a1 Prupe.1G512000_v2.0.a1
pyrus_communis	pycom08g15250 pycom15g32670
rosa_chinensis	RchiOBHm_Chr2g0140771 RchiOBHm_Chr2g0144971 RchiOBHm_Chr7g0239931
rosa_laevigata	RLG00000000716 RLG00000013564 RLG00000020589
rosa_multiflora	Rmu_co8457723.1_g000001 Rmu_sc0000540.1_g000024 Rmu_sc0001684.1_g000001 Rmu_sc0006326.1_g000027 Rmu_sc0041871.1_g000001 Rmu_sc0041872.1_g000001
rosa_roxburghii	Rroxscaffold_3G00220610
rosa_rugosa	Rorug03G0235100 Rorug07G0331300 Rorug07G0331300
rosa_samantha	Rh1CG081500 Rh1DG087900 Rh4AG110300 Rh4DG033300 Rh5BG555900 Rh5CG578700 Rh5DG265800 Rh7AG485000 Rh7BG458000 Rh7DG470600
rosa_wichuraiana	Rw7G040680

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	3599
AarI	CACCTGC	4 cut(s)	184, 1174, 2275, 3848
AatII	GACGTC	2 cut(s)	1340, 2783
Acc16I	TGCGCA	1 cut(s)	4203
Acc36I	ACCTGC	4 cut(s)	184, 1174, 2275, 3848
AccB1I	GGYRCC	1 cut(s)	1002
AccB7I	CCANNNNNTGG	2 cut(s)	650, 1436
AccI	GTMKAC	5 cut(s)	3757, 3847, 4040, 4083, 5361
AccII	CGCG	1 cut(s)	5088
AccIII	TCCGGA	2 cut(s)	5125, 5829
AcoI	YGGCCR	2 cut(s)	330, 336
AcsI	RAATTY	7 cut(s)	1272, 1626, 1632, 1644, 2627, 4615, 5381
AcvI	CACGTG	1 cut(s)	4358
AcyI	GRCGYC	2 cut(s)	1337, 2780
AdeI	CACNNNGTG	1 cut(s)	1206
AflIII	ACRYGT	2 cut(s)	469, 1561
AhlI	ACTAGT	1 cut(s)	1451
AjnI	CCWGG	9 cut(s)	403, 487, 684, 864, 877, 1954, 2400, 4822, 5282
AjuI	GAANNNNNNNTTGG	2 cut(s)	2404, 2436
AleI	CACNNNNGTG	1 cut(s)	978
AloI	GAACNNNNNNTCC	2 cut(s)	2535, 2567
Alw21I	GWGCWC	8 cut(s)	1194, 1591, 2949, 3027, 3331, 3643, 4651, 5085
Alw26I	GTCTC	9 cut(s)	1043, 1587, 2150, 3365, 3660, 4700, 4781, 4977, 5409
Alw44I	GTGCAC	2 cut(s)	3327, 3639
AlwNI	CAGNNNCTG	6 cut(s)	176, 1118, 1202, 1471, 5289, 5744
Ama87I	CYCGRG	4 cut(s)	557, 1584, 2811, 5337
Aor13HI	TCCGGA	2 cut(s)	5125, 5829
ApaI	GGGCCC	1 cut(s)	3907
ApaLI	GTGCAC	2 cut(s)	3327, 3639
ApoI	RAATTY	7 cut(s)	1272, 1626, 1632, 1644, 2627, 4615, 5381
AseI	ATTAAT	2 cut(s)	611, 4269
Asp700I	GAANNNNTTC	2 cut(s)	30, 3232
AspLEI	GCGC	3 cut(s)	2898, 2976, 4204
AsuC2I	CCSGG	1 cut(s)	4610
AsuII	TTCGAA	1 cut(s)	4992
AvaI	CYCGRG	4 cut(s)	557, 1584, 2811, 5337
AvaII	GGWCC	8 cut(s)	159, 823, 1025, 1952, 4164, 4728, 5128, 5698
AxyI	CCTNAGG	2 cut(s)	4857, 5033
BaeGI	GKGCMC	3 cut(s)	3331, 3643, 3907
BaeI	ACNNNNGTAYC	2 cut(s)	3071, 3104
BalI	TGGCCA	2 cut(s)	332, 338
BamHI	GGATCC	3 cut(s)	1426, 4579, 4998
BanI	GGYRCC	1 cut(s)	1002
BanII	GRGCYC	4 cut(s)	1591, 2743, 3907, 5085
BarI	GAAGNNNNNNTAC	6 cut(s)	624, 656, 921, 953, 1986, 2018
BauI	CACGAG	3 cut(s)	3569, 4050, 4629
BbrPI	CACGTG	1 cut(s)	4358
BbsI	GAAGAC	3 cut(s)	107, 354, 2084
Bbv12I	GWGCWC	8 cut(s)	1194, 1591, 2949, 3027, 3331, 3643, 4651, 5085
BceAI	ACGGC	2 cut(s)	963, 5172
BcgI	CGANNNNNNTGC	2 cut(s)	1058, 1092
BciT130I	CCWGG	9 cut(s)	405, 489, 686, 866, 879, 1956, 2402, 4824, 5284
BciVI	GTATCC	2 cut(s)	8, 3268
BclI	TGATCA	6 cut(s)	385, 946, 3367, 3376, 4225, 5571
BcnI	CCSGG	1 cut(s)	4610
BcoDI	GTCTC	9 cut(s)	1043, 1587, 2150, 3365, 3660, 4700, 4781, 4977, 5409
BcuI	ACTAGT	1 cut(s)	1451
BfmI	CTRYAG	4 cut(s)	168, 177, 1035, 5318
BfoI	RGCGCY	2 cut(s)	2899, 2977
BfuAI	ACCTGC	4 cut(s)	184, 1174, 2275, 3848
BfuI	GTATCC	2 cut(s)	8, 3268
BglII	AGATCT	3 cut(s)	1672, 3470, 5555
BlpI	GCTNAGC	1 cut(s)	4526
BmcAI	AGTACT	2 cut(s)	1154, 1541
Bme18I	GGWCC	8 cut(s)	159, 823, 1025, 1952, 4164, 4728, 5128, 5698
BmeT110I	CYCGRG	4 cut(s)	557, 1584, 2811, 5337
BmrI	ACTGGG	1 cut(s)	1190
BmuI	ACTGGG	1 cut(s)	1190
BpiI	GAAGAC	3 cut(s)	107, 354, 2084
BplI	GAGNNNNNCTC	2 cut(s)	4917, 4949
BpmI	CTGGAG	8 cut(s)	1542, 2295, 3545, 3826, 4461, 4569, 4978, 5243
Bpu10I	CCTNAGC	2 cut(s)	516, 1872
Bpu1102I	GCTNAGC	1 cut(s)	4526
Bpu14I	TTCGAA	1 cut(s)	4992
BpuEI	CTTGAG	7 cut(s)	603, 1871, 2720, 3774, 4180, 5195, 5748
BpuMI	CCSGG	1 cut(s)	4610
Bsa29I	ATCGAT	1 cut(s)	5565
BsaAI	YACGTR	5 cut(s)	136, 272, 2015, 4256, 4358
BsaBI	GATNNNNATC	4 cut(s)	2133, 2199, 3780, 5195
BsaHI	GRCGYC	2 cut(s)	1337, 2780
BsaI	GGTCTC	2 cut(s)	3365, 4977
BsaWI	WCCGGW	2 cut(s)	5125, 5829
BsaXI	ACNNNNNCTCC	6 cut(s)	1024, 1054, 3579, 3609, 5085, 5115
Bse118I	RCCGGY	1 cut(s)	3417
Bse21I	CCTNAGG	2 cut(s)	4857, 5033
Bse3DI	GCAATG	4 cut(s)	2316, 3219, 4185, 4452
Bse8I	GATNNNNATC	4 cut(s)	2133, 2199, 3780, 5195
BseAI	TCCGGA	2 cut(s)	5125, 5829
BseBI	CCWGG	9 cut(s)	405, 489, 686, 866, 879, 1956, 2402, 4824, 5284
BseCI	ATCGAT	1 cut(s)	5565
BseJI	GATNNNNATC	4 cut(s)	2133, 2199, 3780, 5195
BseMI	GCAATG	4 cut(s)	2316, 3219, 4185, 4452
BseRI	GAGGAG	6 cut(s)	200, 1034, 1653, 3587, 3975, 5451
BseSI	GKGCMC	3 cut(s)	3331, 3643, 3907
BseYI	CCCAGC	2 cut(s)	772, 4719
BsgI	GTGCAG	1 cut(s)	3876
Bsh1236I	CGCG	1 cut(s)	5088
Bsh1285I	CGRYCG	1 cut(s)	696
BshNI	GGYRCC	1 cut(s)	1002
BshVI	ATCGAT	1 cut(s)	5565
BsiEI	CGRYCG	1 cut(s)	696
BsiHKAI	GWGCWC	8 cut(s)	1194, 1591, 2949, 3027, 3331, 3643, 4651, 5085
BsiHKCI	CYCGRG	4 cut(s)	557, 1584, 2811, 5337
BsiSI	CCGG	5 cut(s)	3418, 4610, 5116, 5126, 5830
BslFI	GGGAC	3 cut(s)	145, 159, 1804
BsmAI	GTCTC	9 cut(s)	1043, 1587, 2150, 3365, 3660, 4700, 4781, 4977, 5409
BsmBI	CGTCTC	2 cut(s)	4700, 5409
BsmFI	GGGAC	3 cut(s)	145, 159, 1804
BsmI	GAATGC	3 cut(s)	1257, 2573, 4204
Bso31I	GGTCTC	2 cut(s)	3365, 4977
BsoBI	CYCGRG	4 cut(s)	557, 1584, 2811, 5337
Bsp119I	TTCGAA	1 cut(s)	4992
Bsp120I	GGGCCC	1 cut(s)	3903
Bsp13I	TCCGGA	2 cut(s)	5125, 5829
Bsp1407I	TGTACA	2 cut(s)	1131, 4071
Bsp1720I	GCTNAGC	1 cut(s)	4526
Bsp19I	CCATGG	4 cut(s)	333, 644, 2383, 3270
BspDI	ATCGAT	1 cut(s)	5565
BspEI	TCCGGA	2 cut(s)	5125, 5829
BspFNI	CGCG	1 cut(s)	5088
BspHI	TCATGA	5 cut(s)	1534, 2131, 3667, 4840, 5395
BspMAI	CTGCAG	2 cut(s)	172, 181
BspMI	ACCTGC	4 cut(s)	184, 1174, 2275, 3848
BspT104I	TTCGAA	1 cut(s)	4992
BspT107I	GGYRCC	1 cut(s)	1002
BspTNI	GGTCTC	2 cut(s)	3365, 4977
BsrDI	GCAATG	4 cut(s)	2316, 3219, 4185, 4452
BsrFI	RCCGGY	1 cut(s)	3417
BsrGI	TGTACA	2 cut(s)	1131, 4071
BssAI	RCCGGY	1 cut(s)	3417
BssNAI	GTATAC	1 cut(s)	4041
BssNI	GRCGYC	2 cut(s)	1337, 2780
BssSI	CACGAG	3 cut(s)	3569, 4050, 4629
BssT1I	CCWWGG	7 cut(s)	202, 333, 644, 1766, 2383, 3270, 4575
Bst1107I	GTATAC	1 cut(s)	4041
Bst2BI	CACGAG	3 cut(s)	3569, 4050, 4629
Bst2UI	CCWGG	9 cut(s)	405, 489, 686, 866, 879, 1956, 2402, 4824, 5284
Bst6I	CTCTTC	4 cut(s)	2791, 2832, 3615, 4179
BstACI	GRCGYC	2 cut(s)	1337, 2780
BstAPI	GCANNNNNTGC	4 cut(s)	176, 536, 2518, 4454
BstAUI	TGTACA	2 cut(s)	1131, 4071
BstBAI	YACGTR	5 cut(s)	136, 272, 2015, 4256, 4358
BstBI	TTCGAA	1 cut(s)	4992
BstDSI	CCRYGG	5 cut(s)	333, 644, 2383, 3270, 5086
BstEII	GGTNACC	1 cut(s)	767
BstENI	CCTNNNNNAGG	1 cut(s)	3440
BstFNI	CGCG	1 cut(s)	5088
BstH2I	RGCGCY	2 cut(s)	2899, 2977
BstHHI	GCGC	3 cut(s)	2898, 2976, 4204
BstMAI	GTCTC	9 cut(s)	1043, 1587, 2150, 3365, 3660, 4700, 4781, 4977, 5409
BstMCI	CGRYCG	1 cut(s)	696
BstNI	CCWGG	9 cut(s)	405, 489, 686, 866, 879, 1956, 2402, 4824, 5284
BstNSI	RCATGY	6 cut(s)	79, 473, 662, 723, 1565, 1685
BstPI	GGTNACC	1 cut(s)	767
BstSFI	CTRYAG	4 cut(s)	168, 177, 1035, 5318
BstSLI	GKGCMC	3 cut(s)	3331, 3643, 3907
BstSNI	TACGTA	2 cut(s)	136, 272
BstUI	CGCG	1 cut(s)	5088
BstV2I	GAAGAC	3 cut(s)	107, 354, 2084
BstXI	CCANNNNNNTGG	2 cut(s)	1497, 4550
BstZ17I	GTATAC	1 cut(s)	4041
Bsu15I	ATCGAT	1 cut(s)	5565
Bsu36I	CCTNAGG	2 cut(s)	4857, 5033
BsuI	GTATCC	2 cut(s)	8, 3268
BsuTUI	ATCGAT	1 cut(s)	5565
BtgI	CCRYGG	5 cut(s)	333, 644, 2383, 3270, 5086
BtgZI	GCGATG	1 cut(s)	1838
BtsI	GCAGTG	2 cut(s)	994, 3467
BtsIMutI	CAGTG	9 cut(s)	994, 1143, 1200, 2872, 3467, 3641, 3859, 3925, 4212
BveI	ACCTGC	4 cut(s)	184, 1174, 2275, 3848
CaiI	CAGNNNCTG	6 cut(s)	176, 1118, 1202, 1471, 5289, 5744
CciI	TCATGA	5 cut(s)	1534, 2131, 3667, 4840, 5395
CfoI	GCGC	3 cut(s)	2898, 2976, 4204
Cfr10I	RCCGGY	1 cut(s)	3417
Cfr42I	CCGCGG	1 cut(s)	5089
ClaI	ATCGAT	1 cut(s)	5565
CseI	GACGC	4 cut(s)	3959, 4717, 4810, 5474
CspCI	CAANNNNNGTGG	6 cut(s)	1339, 1374, 1700, 1735, 5004, 5039
DraI	TTTAAA	3 cut(s)	1444, 1480, 1801
DraIII	CACNNNGTG	1 cut(s)	1206
EaeI	YGGCCR	2 cut(s)	330, 336
Eam1104I	CTCTTC	4 cut(s)	2791, 2832, 3615, 4179
EarI	CTCTTC	4 cut(s)	2791, 2832, 3615, 4179
Ecl136II	GAGCTC	2 cut(s)	1589, 5083
Eco105I	TACGTA	2 cut(s)	136, 272
Eco130I	CCWWGG	7 cut(s)	202, 333, 644, 1766, 2383, 3270, 4575
Eco147I	AGGCCT	1 cut(s)	1762
Eco24I	GRGCYC	4 cut(s)	1591, 2743, 3907, 5085
Eco31I	GGTCTC	2 cut(s)	3365, 4977
Eco47I	GGWCC	8 cut(s)	159, 823, 1025, 1952, 4164, 4728, 5128, 5698
Eco53kI	GAGCTC	2 cut(s)	1589, 5083
Eco72I	CACGTG	1 cut(s)	4358
Eco81I	CCTNAGG	2 cut(s)	4857, 5033
Eco88I	CYCGRG	4 cut(s)	557, 1584, 2811, 5337
Eco91I	GGTNACC	1 cut(s)	767
EcoICRI	GAGCTC	2 cut(s)	1589, 5083
EcoNI	CCTNNNNNAGG	1 cut(s)	3440
EcoO109I	RGGNCCY	5 cut(s)	159, 1952, 2405, 3904, 4164
EcoO65I	GGTNACC	1 cut(s)	767
EcoRI	GAATTC	1 cut(s)	4615
EcoRII	CCWGG	9 cut(s)	403, 487, 684, 864, 877, 1954, 2400, 4822, 5282
EcoT14I	CCWWGG	7 cut(s)	202, 333, 644, 1766, 2383, 3270, 4575
EcoT22I	ATGCAT	4 cut(s)	505, 532, 3723, 4392
EcoT38I	GRGCYC	4 cut(s)	1591, 2743, 3907, 5085
ErhI	CCWWGG	7 cut(s)	202, 333, 644, 1766, 2383, 3270, 4575
Esp3I	CGTCTC	2 cut(s)	4700, 5409
FalI	AAGNNNNNCTT	8 cut(s)	1750, 1782, 2736, 2768, 3336, 3368, 4986, 5018
FaqI	GGGAC	3 cut(s)	145, 159, 1804
FauI	CCCGC	5 cut(s)	1737, 2597, 3387, 3894, 5688
FauNDI	CATATG	2 cut(s)	2221, 4236
FbaI	TGATCA	6 cut(s)	385, 946, 3367, 3376, 4225, 5571
FblI	GTMKAC	5 cut(s)	3757, 3847, 4040, 4083, 5361
FriOI	GRGCYC	4 cut(s)	1591, 2743, 3907, 5085
FspAI	RTGCGCAY	1 cut(s)	4203
FspI	TGCGCA	1 cut(s)	4203
GlaI	GCGC	3 cut(s)	2897, 2975, 4203
GsaI	CCCAGC	2 cut(s)	776, 4723
GsuI	CTGGAG	8 cut(s)	1542, 2295, 3545, 3826, 4461, 4569, 4978, 5243
HaeII	RGCGCY	2 cut(s)	2899, 2977
HapII	CCGG	5 cut(s)	3418, 4610, 5116, 5126, 5830
HgaI	GACGC	4 cut(s)	3959, 4717, 4810, 5474
HhaI	GCGC	3 cut(s)	2898, 2976, 4204
Hin1I	GRCGYC	2 cut(s)	1337, 2780
Hin6I	GCGC	3 cut(s)	2896, 2974, 4202
HinP1I	GCGC	3 cut(s)	2896, 2974, 4202
HincII	GTYRAC	1 cut(s)	1099
HindII	GTYRAC	1 cut(s)	1099
HindIII	AAGCTT	4 cut(s)	2452, 4013, 4751, 5270
HpaI	GTTAAC	1 cut(s)	1099
HpaII	CCGG	5 cut(s)	3418, 4610, 5116, 5126, 5830
Hpy99I	CGWCG	1 cut(s)	5490
HpyCH4IV	ACGT	8 cut(s)	135, 271, 1337, 2014, 2780, 4255, 4357, 5402
HpySE526I	ACGT	8 cut(s)	135, 271, 1337, 2014, 2780, 4255, 4357, 5402
Hsp92I	GRCGYC	2 cut(s)	1337, 2780
HspAI	GCGC	3 cut(s)	2896, 2974, 4202
Kpn2I	TCCGGA	2 cut(s)	5125, 5829
Ksp22I	TGATCA	6 cut(s)	385, 946, 3367, 3376, 4225, 5571
KspAI	GTTAAC	1 cut(s)	1099
KspI	CCGCGG	1 cut(s)	5089
MaeII	ACGT	8 cut(s)	135, 271, 1337, 2014, 2780, 4255, 4357, 5402
MfeI	CAATTG	3 cut(s)	2291, 2524, 5717
MlsI	TGGCCA	2 cut(s)	332, 338
MluNI	TGGCCA	2 cut(s)	332, 338
MlyI	GAGTC	8 cut(s)	1589, 1786, 1991, 3063, 3597, 3763, 4926, 5498
Mox20I	TGGCCA	2 cut(s)	332, 338
Mph1103I	ATGCAT	4 cut(s)	505, 532, 3723, 4392
MroI	TCCGGA	2 cut(s)	5125, 5829
MroXI	GAANNNNTTC	2 cut(s)	30, 3232
MscI	TGGCCA	2 cut(s)	332, 338
MslI	CAYNNNNRTG	9 cut(s)	474, 831, 957, 978, 2205, 3036, 4235, 4548, 5069
Msp20I	TGGCCA	2 cut(s)	332, 338
MspA1I	CMGCKG	7 cut(s)	569, 681, 2081, 2360, 5088, 5251, 5545
MspI	CCGG	5 cut(s)	3418, 4610, 5116, 5126, 5830
MunI	CAATTG	3 cut(s)	2291, 2524, 5717
Mva1269I	GAATGC	3 cut(s)	1257, 2573, 4204
MvaI	CCWGG	9 cut(s)	405, 489, 686, 866, 879, 1956, 2402, 4824, 5284
MvnI	CGCG	1 cut(s)	5088
NciI	CCSGG	1 cut(s)	4610
NcoI	CCATGG	4 cut(s)	333, 644, 2383, 3270
NdeI	CATATG	2 cut(s)	2221, 4236
NsbI	TGCGCA	1 cut(s)	4203
NsiI	ATGCAT	4 cut(s)	505, 532, 3723, 4392
NspI	RCATGY	6 cut(s)	79, 473, 662, 723, 1565, 1685
NspV	TTCGAA	1 cut(s)	4992
OliI	CACNNNNGTG	1 cut(s)	978
PaeR7I	CTCGAG	1 cut(s)	1584
PagI	TCATGA	5 cut(s)	1534, 2131, 3667, 4840, 5395
PaqCI	CACCTGC	4 cut(s)	184, 1174, 2275, 3848
PceI	AGGCCT	1 cut(s)	1762
PciI	ACATGT	2 cut(s)	469, 1561
PctI	GAATGC	3 cut(s)	1257, 2573, 4204
PdmI	GAANNNNTTC	2 cut(s)	30, 3232
PflMI	CCANNNNNTGG	2 cut(s)	650, 1436
PfoI	TCCNGGA	1 cut(s)	877
Ple19I	CGATCG	1 cut(s)	696
PleI	GAGTC	8 cut(s)	1588, 1786, 1990, 3063, 3596, 3762, 4926, 5498
PmaCI	CACGTG	1 cut(s)	4358
PmlI	CACGTG	1 cut(s)	4358
PpsI	GAGTC	8 cut(s)	1588, 1786, 1990, 3063, 3596, 3762, 4926, 5498
Ppu21I	YACGTR	5 cut(s)	136, 272, 2015, 4256, 4358
PpuMI	RGGWCCY	3 cut(s)	159, 1952, 4164
PscI	ACATGT	2 cut(s)	469, 1561
PshBI	ATTAAT	2 cut(s)	611, 4269
PsiI	TTATAA	1 cut(s)	3599
Psp124BI	GAGCTC	2 cut(s)	1591, 5085
Psp5II	RGGWCCY	3 cut(s)	159, 1952, 4164
Psp6I	CCWGG	9 cut(s)	403, 487, 684, 864, 877, 1954, 2400, 4822, 5282
PspCI	CACGTG	1 cut(s)	4358
PspEI	GGTNACC	1 cut(s)	767
PspFI	CCCAGC	2 cut(s)	772, 4719
PspGI	CCWGG	9 cut(s)	403, 487, 684, 864, 877, 1954, 2400, 4822, 5282
PspOMI	GGGCCC	1 cut(s)	3903
PspPPI	RGGWCCY	3 cut(s)	159, 1952, 4164
PstI	CTGCAG	2 cut(s)	172, 181
PstNI	CAGNNNCTG	6 cut(s)	176, 1118, 1202, 1471, 5289, 5744
PvuI	CGATCG	1 cut(s)	696
PvuII	CAGCTG	6 cut(s)	569, 681, 2081, 2360, 5251, 5545
RseI	CAYNNNNRTG	9 cut(s)	474, 831, 957, 978, 2205, 3036, 4235, 4548, 5069
SacI	GAGCTC	2 cut(s)	1591, 5085
SacII	CCGCGG	1 cut(s)	5089
ScaI	AGTACT	2 cut(s)	1154, 1541
SchI	GAGTC	8 cut(s)	1589, 1786, 1991, 3063, 3597, 3763, 4926, 5498
SfcI	CTRYAG	4 cut(s)	168, 177, 1035, 5318
Sfr274I	CTCGAG	1 cut(s)	1584
Sfr303I	CCGCGG	1 cut(s)	5089
SfuI	TTCGAA	1 cut(s)	4992
SgrBI	CCGCGG	1 cut(s)	5089
SinI	GGWCC	8 cut(s)	159, 823, 1025, 1952, 4164, 4728, 5128, 5698
SlaI	CTCGAG	1 cut(s)	1584
SmiMI	CAYNNNNRTG	9 cut(s)	474, 831, 957, 978, 2205, 3036, 4235, 4548, 5069
SmlI	CTYRAG	8 cut(s)	618, 1584, 1850, 2699, 3789, 4159, 5174, 5763
SmoI	CTYRAG	8 cut(s)	618, 1584, 1850, 2699, 3789, 4159, 5174, 5763
SnaBI	TACGTA	2 cut(s)	136, 272
SpeI	ACTAGT	1 cut(s)	1451
SseBI	AGGCCT	1 cut(s)	1762
SstI	GAGCTC	2 cut(s)	1591, 5085
StuI	AGGCCT	1 cut(s)	1762
StyI	CCWWGG	7 cut(s)	202, 333, 644, 1766, 2383, 3270, 4575
TaiI	ACGT	8 cut(s)	138, 274, 1340, 2017, 2783, 4258, 4360, 5405
TatI	WGTACW	4 cut(s)	1131, 1152, 1539, 4071
TauI	GCSGC	2 cut(s)	1076, 1823
TscAI	CASTG	9 cut(s)	994, 1150, 1207, 2872, 3467, 3648, 3859, 3932, 4219
TspRI	CASTG	9 cut(s)	994, 1150, 1207, 2872, 3467, 3648, 3859, 3932, 4219
Van91I	CCANNNNNTGG	2 cut(s)	650, 1436
VneI	GTGCAC	2 cut(s)	3327, 3639
VpaK11BI	GGWCC	8 cut(s)	159, 823, 1025, 1952, 4164, 4728, 5128, 5698
VspI	ATTAAT	2 cut(s)	611, 4269
XagI	CCTNNNNNAGG	1 cut(s)	3440
XapI	RAATTY	7 cut(s)	1272, 1626, 1632, 1644, 2627, 4615, 5381
XceI	RCATGY	6 cut(s)	79, 473, 662, 723, 1565, 1685
XcmI	CCANNNNNNNNNTGG	3 cut(s)	1203, 1244, 4373
XhoI	CTCGAG	1 cut(s)	1584
XmiI	GTMKAC	5 cut(s)	3757, 3847, 4040, 4083, 5361
XmnI	GAANNNNTTC	2 cut(s)	30, 3232
ZraI	GACGTC	2 cut(s)	1338, 2781
ZrmI	AGTACT	2 cut(s)	1154, 1541
Zsp2I	ATGCAT	4 cut(s)	505, 532, 3723, 4392

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.