Rmu_sc0000893.1_g000010

Sucrose-cleaving enzyme that provides UDP-glucose and fructose for various metabolic pathways

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000893.1
Physical Location & Seq
Forward (+)
39100 .. 39685
586 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000893.1_g000010.1.cds

Sequence Viewer

Length: 330 bp
atgcagtgcaacatcgctcatgcattggagaagacaatgtacccagattctgatatattttggaaaagctatgaggacaagtaccatttctcaagtcaaatcaccgctgatctcattgcaatgaacaatgcagattccataatcaccagtacataccaagagattgcaggaagccagaacaatgttggacagtatcagagccacacagctttcactcttcctgggctgtatccagttgttcacggggttgatgtttttgatcctaagtttaatattgtgtctccaggagcagatatgtgcatattggcatcgaaacccatcttgaactag

Protein Analysis

109

Amino Acids

12.11

Weight (kDa)

4.79

Isoelectric Point (pI)

39.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 105
AclWI GGATC 1 cut(s) 254
AfaI GTAC 3 cut(s) 41, 83, 151
AgsI TTSAA 1 cut(s) 325
AjnI CCWGG 2 cut(s) 220, 283
AluBI AGCT 2 cut(s) 69, 209
AluI AGCT 2 cut(s) 69, 209
Alw26I GTCTC 1 cut(s) 285
AlwI GGATC 1 cut(s) 254
AlwNI CAGNNNCTG 1 cut(s) 50
AsuHPI GGTGA 2 cut(s) 94, 136
BarI GAAGNNNNNNTAC 2 cut(s) 23, 55
BbsI GAAGAC 1 cut(s) 38
BccI CCATC 1 cut(s) 326
BciT130I CCWGG 2 cut(s) 222, 285
BciVI GTATCC 1 cut(s) 240
BcoDI GTCTC 1 cut(s) 285
BfaI CTAG 1 cut(s) 328
BfuI GTATCC 1 cut(s) 240
Bme1390I CCNGG 2 cut(s) 222, 285
BmrFI CCNGG 2 cut(s) 222, 285
BmsI GCATC 1 cut(s) 317
BpiI GAAGAC 1 cut(s) 38
BpmI CTGGAG 1 cut(s) 267
BpuEI CTTGAG 1 cut(s) 76
BsaJI CCNNGG 1 cut(s) 221
Bse1I ACTGG 2 cut(s) 147, 233
Bse3DI GCAATG 2 cut(s) 114, 126
BseBI CCWGG 2 cut(s) 222, 285
BseDI CCNNGG 1 cut(s) 221
BseMI GCAATG 2 cut(s) 114, 126
BseNI ACTGG 2 cut(s) 147, 233
BsmAI GTCTC 1 cut(s) 285
Bsp143I GATC 2 cut(s) 109, 259
BspACI CCGC 1 cut(s) 105
BspPI GGATC 1 cut(s) 254
BsrDI GCAATG 2 cut(s) 114, 126
BsrI ACTGG 2 cut(s) 147, 233
BssECI CCNNGG 1 cut(s) 221
BssMI GATC 2 cut(s) 109, 259
Bst2UI CCWGG 2 cut(s) 222, 285
Bst4CI ACNGT 1 cut(s) 192
Bst6I CTCTTC 1 cut(s) 222
BstDEI CTNAG 1 cut(s) 264
BstKTI GATC 2 cut(s) 112, 262
BstMAI GTCTC 1 cut(s) 285
BstMBI GATC 2 cut(s) 109, 259
BstNI CCWGG 2 cut(s) 222, 285
BstSCI CCNGG 2 cut(s) 220, 283
BstV2I GAAGAC 1 cut(s) 38
BsuI GTATCC 1 cut(s) 240
BtsI GCAGTG 1 cut(s) 11
BtsIMutI CAGTG 1 cut(s) 11
CaiI CAGNNNCTG 1 cut(s) 50
Csp6I GTAC 3 cut(s) 40, 82, 150
CviAII CATG 1 cut(s) 20
CviJI RGCY 5 cut(s) 69, 174, 201, 209, 226
CviKI_1 RGCY 5 cut(s) 69, 174, 201, 209, 226
CviQI GTAC 3 cut(s) 40, 82, 150
DdeI CTNAG 1 cut(s) 264
DpnI GATC 2 cut(s) 111, 261
DpnII GATC 2 cut(s) 109, 259
Eam1104I CTCTTC 1 cut(s) 222
EarI CTCTTC 1 cut(s) 222
EcoRII CCWGG 2 cut(s) 220, 283
EcoT22I ATGCAT 1 cut(s) 25
FaeI CATG 1 cut(s) 23
FaiI YATR 7 cut(s) 21, 56, 72, 140, 154, 296, 302
FatI CATG 1 cut(s) 19
FspBI CTAG 1 cut(s) 328
GsuI CTGGAG 1 cut(s) 267
Hin1II CATG 1 cut(s) 23
HinfI GANTC 2 cut(s) 47, 134
HphI GGTGA 2 cut(s) 94, 136
Hpy166II GTNNAC 1 cut(s) 241
Hpy188I TCNGA 2 cut(s) 52, 198
Hpy188III TCNNGA 1 cut(s) 322
Hpy8I GTNNAC 1 cut(s) 241
HpyCH4III ACNGT 1 cut(s) 192
HpyCH4V TGCA 7 cut(s) 4, 9, 23, 119, 131, 167, 300
HpyF3I CTNAG 1 cut(s) 264
Hsp92II CATG 1 cut(s) 23
Kzo9I GATC 2 cut(s) 109, 259
LmnI GCTCC 1 cut(s) 287
LpnPI CCDG 9 cut(s) 57, 153, 160, 188, 207, 234, 246, 270, 297
LweI GCATC 1 cut(s) 317
MaeI CTAG 1 cut(s) 328
MalI GATC 2 cut(s) 111, 261
MboI GATC 2 cut(s) 109, 259
MboII GAAGA 2 cut(s) 43, 209
MmeI TCCRAC 1 cut(s) 166
MnlI CCTC 1 cut(s) 67
Mph1103I ATGCAT 1 cut(s) 25
MseI TTAA 1 cut(s) 270
MslI CAYNNNNRTG 1 cut(s) 119
MspA1I CMGCKG 1 cut(s) 107
MspR9I CCNGG 2 cut(s) 222, 285
MvaI CCWGG 2 cut(s) 222, 285
NdeII GATC 2 cut(s) 109, 259
NlaIII CATG 1 cut(s) 23
NsiI ATGCAT 1 cut(s) 25
PfeI GAWTC 2 cut(s) 47, 134
PfoI TCCNGGA 1 cut(s) 283
Psp6I CCWGG 2 cut(s) 220, 283
PspGI CCWGG 2 cut(s) 220, 283
PstNI CAGNNNCTG 1 cut(s) 50
RsaI GTAC 3 cut(s) 41, 83, 151
RsaNI GTAC 3 cut(s) 40, 82, 150
RseI CAYNNNNRTG 1 cut(s) 119
SaqAI TTAA 1 cut(s) 270
Sau3AI GATC 2 cut(s) 109, 259
ScrFI CCNGG 2 cut(s) 222, 285
SetI ASST 2 cut(s) 71, 211
SfaNI GCATC 1 cut(s) 317
SmiMI CAYNNNNRTG 1 cut(s) 119
SmlI CTYRAG 1 cut(s) 91
SmoI CTYRAG 1 cut(s) 91
SsiI CCGC 1 cut(s) 105
SspI AATATT 1 cut(s) 274
SspMI CTAG 1 cut(s) 328
StyD4I CCNGG 2 cut(s) 220, 283
TaaI ACNGT 1 cut(s) 192
TaqI TCGA 1 cut(s) 311
TatI WGTACW 1 cut(s) 149
TfiI GAWTC 2 cut(s) 47, 134
Tru1I TTAA 1 cut(s) 270
Tru9I TTAA 1 cut(s) 270
TspDTI ATGAA 1 cut(s) 137
XcmI CCANNNNNNNNNTGG 1 cut(s) 182
XspI CTAG 1 cut(s) 328
Zsp2I ATGCAT 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.