Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000946.1

Orthogroup ID

OG0002611

Physical Location & Seq

Genomic Coordinates Reverse (-)

68169 .. 70294

Gene Structure 2126 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000946.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1503 bp

atgtgcaaagcaggggactttgagaggtgtgattacagaacagagtggaagatgggatacaaggttttgagtaatgtagagaaattgaagaactcaattttcaagatgaactcatggttgttgatcatgagagcaattgtgacagctttggtttgggcctctgcggttcagttgattgggatttggttgattagagggccaagagtgttcaaggtttggcctccttgtaatcaattagatttgcacgttgcttctgaattgccgaagcttccaatcccagttttcccaccaaagagggtttataagaataatgggtatctaatggtttcttgcaatggaggattgaatcaaatgcgagcagcgatttgtgatatggttgcaattgccagatatttgaatgtgactcttatcgttccagagctggataagaactcattttgggctgcgagtgagtttcaagacattttcgatgttaatcatttcattagatcattgagagatgaggttcggatactaaagaaactgcccccaaagctcaacaagagagcagtatactcattgccacctgttagttggtccaacatttcctactacattcatcagatcctaccgctggtgcgaaagtataaagtagtgcatttgaacaaaaccgatgctcgagtggctaacaatgggctaccccttgagattcagaagttgagatgcagagtcaatttccatggtctgagatttacttcccagatagaggaaaccggtcgaaagcttgtcagaattttaagagaaaaaggcccttttctggtgcttcatctcagatatgaaatggacatgttggcattctctggctgcagccatggttgcaccaatgatgaggtggaagaactcaacacaatgagatatgctaatccattgtggaaggaaaaagacattgattctgaaatgaaaagggtagaaggcttgtgccctctaacaccagaggaaactgctctggtattggttgcattaggtatagatcacaatgttcagatttatattgctgccggagacatatacggtggagatcgaagaatggaaggtttgaaagctgcttttcctaatgtggtcaggaaagagacgctgctcgagccttcggaattgaggttcttcccaaaccactcttctcaaatggcagcattggactaccttgtgtctctggagagtgacattttcgttcctacatacgatggaaacatggccaaagttgttgaaggccatcgcaggttcttaggtttcaaaaagactattttactagacagaaggcttctcattggtttgatagatcagtttactagtggatcattgtgctgggatgagttctcttccattgtgaaggaagctcatgccgatcggatggggagcccgaaaaaacgagtttctattgttgataaaccaaaagaagaagactacttctactcaaatccacatgaatgtttgcaactgttagataagccattgagaacaacatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0044424 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

O-FucT

Protein Analysis

500

Amino Acids

57.48

Weight (kDa)

9.05

Isoelectric Point (pI)

38.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002611)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G02250 AT5G15740
fragaria_vesca	FvH4_5g13360 FvH4_5g13360 FvH4_6g46300 FvH4_6g46300
malus_domestica	MD06G1206100.v1.1 MD09G1075800.v1.1 MD14G1217000.v1.1 MD17G1066500.v1.1
prunus_persica	Prupe.3G248200_v2.0.a1 Prupe.3G248200_v2.0.a1 Prupe.3G248200_v2.0.a1 Prupe.5G210400_v2.0.a1 Prupe.5G210400_v2.0.a1
pyrus_communis	pycom09g00320 pycom14g17970 pycom17g06700
rosa_chinensis	RchiOBHm_Chr2g0164751 RchiOBHm_Chr7g0183771
rosa_laevigata	RLG00000005024 RLG00000021482
rosa_multiflora	Rmu_sc0000946.1_g000016 Rmu_sc0003610.1_g000037
rosa_roxburghii	Rroxscaffold_2G00086330 Rroxscaffold_3G00270220
rosa_rugosa	Rorug02G0509800 Rorug02G0509800 Rorug02G0509900 Rorug06G0460200 Rorug06G0460300 Rorug06G0460400
rosa_samantha	Rh2AG578200 Rh2BG589300 Rh2CG559900 Rh2DG599700 Rh7CG062600 Rh7DG061000
rosa_wichuraiana	Rw2G048000 Rw7G005060

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	303
Acc36I	ACCTGC	1 cut(s)	1245
AccI	GTMKAC	1 cut(s)	552
AciI	CCGC	2 cut(s)	164, 611
AclWI	GGATC	2 cut(s)	598, 1339
AcoI	YGGCCR	1 cut(s)	1230
AcsI	RAATTY	1 cut(s)	771
AfiI	CCNNNNNNNGG	3 cut(s)	613, 745, 796
AflIII	ACRYGT	1 cut(s)	825
AgeI	ACCGGT	1 cut(s)	752
AhlI	ACTAGT	1 cut(s)	1325
AjuI	GAANNNNNNNTTGG	2 cut(s)	1138, 1170
AloI	GAACNNNNNNTCC	2 cut(s)	1121, 1153
AluBI	AGCT	7 cut(s)	146, 268, 421, 535, 763, 1082, 1373
AluI	AGCT	7 cut(s)	146, 268, 421, 535, 763, 1082, 1373
Alw26I	GTCTC	3 cut(s)	1035, 1103, 1191
AlwI	GGATC	2 cut(s)	598, 1339
Ama87I	CYCGRG	2 cut(s)	657, 1118
AoxI	GGCC	6 cut(s)	156, 197, 218, 787, 1230, 1246
ApeKI	GCWGC	8 cut(s)	359, 443, 843, 846, 1034, 1082, 1114, 1166
ApoI	RAATTY	1 cut(s)	771
AsiGI	ACCGGT	1 cut(s)	752
AspS9I	GGNCC	4 cut(s)	156, 197, 576, 788
AvaI	CYCGRG	2 cut(s)	657, 1118
AvaII	GGWCC	1 cut(s)	576
BaeGI	GKGCMC	1 cut(s)	962
BalI	TGGCCA	1 cut(s)	1232
BanII	GRGCYC	1 cut(s)	1397
BarI	GAAGNNNNNNTAC	2 cut(s)	41, 73
BbsI	GAAGAC	1 cut(s)	1443
BbvI	GCAGC	8 cut(s)	371, 430, 830, 858, 1021, 1069, 1101, 1178
BccI	CCATC	4 cut(s)	46, 1214, 1257, 1381
BciVI	GTATCC	2 cut(s)	50, 504
BclI	TGATCA	1 cut(s)	123
BcoDI	GTCTC	3 cut(s)	1035, 1103, 1191
BcuI	ACTAGT	1 cut(s)	1325
BfaI	CTAG	2 cut(s)	1286, 1326
BfmI	CTRYAG	1 cut(s)	844
BfuAI	ACCTGC	1 cut(s)	1245
BfuI	GTATCC	2 cut(s)	50, 504
BisI	GCNGC	8 cut(s)	360, 444, 844, 847, 1035, 1083, 1115, 1167
BlsI	GCNGC	8 cut(s)	361, 445, 845, 848, 1036, 1084, 1116, 1168
Bme18I	GGWCC	1 cut(s)	576
BmeT110I	CYCGRG	2 cut(s)	657, 1118
BmgT120I	GGNCC	4 cut(s)	156, 197, 576, 788
BmiI	GGNNCC	1 cut(s)	1394
BmrI	ACTGGG	1 cut(s)	272
BmsI	GCATC	2 cut(s)	643, 692
BmuI	ACTGGG	1 cut(s)	272
BpiI	GAAGAC	1 cut(s)	1443
BpmI	CTGGAG	1 cut(s)	1211
BpuEI	CTTGAG	1 cut(s)	704
BsaBI	GATNNNNATC	1 cut(s)	474
BsaJI	CCNNGG	2 cut(s)	718, 850
BsaWI	WCCGGW	1 cut(s)	752
Bsc4I	CCNNNNNNNGG	3 cut(s)	613, 745, 796
Bse118I	RCCGGY	1 cut(s)	752
Bse1I	ACTGG	1 cut(s)	278
Bse3DI	GCAATG	2 cut(s)	340, 557
Bse8I	GATNNNNATC	1 cut(s)	474
BseDI	CCNNGG	2 cut(s)	718, 850
BseGI	GGATG	2 cut(s)	1351, 1392
BseJI	GATNNNNATC	1 cut(s)	474
BseLI	CCNNNNNNNGG	3 cut(s)	613, 745, 796
BseMI	GCAATG	2 cut(s)	340, 557
BseMII	CTCAG	2 cut(s)	716, 823
BseNI	ACTGG	1 cut(s)	278
BseSI	GKGCMC	1 cut(s)	962
BseXI	GCAGC	8 cut(s)	371, 430, 830, 858, 1021, 1069, 1101, 1178
BseYI	CCCAGC	1 cut(s)	1341
Bsh1285I	CGRYCG	2 cut(s)	757, 1384
BshFI	GGCC	6 cut(s)	158, 199, 220, 789, 1232, 1248
BshTI	ACCGGT	1 cut(s)	752
BsiEI	CGRYCG	2 cut(s)	757, 1384
BsiHKCI	CYCGRG	2 cut(s)	657, 1118
BsiSI	CCGG	2 cut(s)	753, 1038
BslFI	GGGAC	1 cut(s)	29
BslI	CCNNNNNNNGG	3 cut(s)	613, 745, 796
BsmAI	GTCTC	3 cut(s)	1035, 1103, 1191
BsmBI	CGTCTC	1 cut(s)	1103
BsmFI	GGGAC	1 cut(s)	29
BsmI	GAATGC	1 cut(s)	833
BsnI	GGCC	6 cut(s)	158, 199, 220, 789, 1232, 1248
BsoBI	CYCGRG	2 cut(s)	657, 1118
Bsp1286I	GDGCHC	2 cut(s)	962, 1397
Bsp143I	GATC	8 cut(s)	123, 488, 603, 1009, 1057, 1315, 1331, 1381
Bsp19I	CCATGG	2 cut(s)	718, 850
BspACI	CCGC	2 cut(s)	164, 611
BspANI	GGCC	6 cut(s)	158, 199, 220, 789, 1232, 1248
BspCNI	CTCAG	2 cut(s)	717, 822
BspHI	TCATGA	1 cut(s)	126
BspLI	GGNNCC	1 cut(s)	1394
BspMAI	CTGCAG	1 cut(s)	848
BspMI	ACCTGC	1 cut(s)	1245
BspPI	GGATC	2 cut(s)	598, 1339
BsrDI	GCAATG	2 cut(s)	340, 557
BsrFI	RCCGGY	1 cut(s)	752
BsrI	ACTGG	1 cut(s)	278
BssAI	RCCGGY	1 cut(s)	752
BssECI	CCNNGG	2 cut(s)	718, 850
BssMI	GATC	8 cut(s)	123, 488, 603, 1009, 1057, 1315, 1331, 1381
BssNAI	GTATAC	1 cut(s)	553
BssT1I	CCWWGG	2 cut(s)	718, 850
Bst1107I	GTATAC	1 cut(s)	553
Bst4CI	ACNGT	2 cut(s)	1052, 1476
Bst6I	CTCTTC	2 cut(s)	1159, 1360
BstC8I	GCNNGC	1 cut(s)	357
BstDEI	CTNAG	3 cut(s)	725, 809, 1261
BstDSI	CCRYGG	2 cut(s)	718, 850
BstF5I	GGATG	2 cut(s)	1351, 1392
BstKTI	GATC	8 cut(s)	126, 491, 606, 1012, 1060, 1318, 1334, 1384
BstMAI	GTCTC	3 cut(s)	1035, 1103, 1191
BstMBI	GATC	8 cut(s)	123, 488, 603, 1009, 1057, 1315, 1331, 1381
BstMCI	CGRYCG	2 cut(s)	757, 1384
BstMWI	GCNNNNNNNGC	4 cut(s)	532, 662, 855, 1120
BstNSI	RCATGY	1 cut(s)	829
BstSFI	CTRYAG	1 cut(s)	844
BstSLI	GKGCMC	1 cut(s)	962
BstV1I	GCAGC	8 cut(s)	371, 430, 830, 858, 1021, 1069, 1101, 1178
BstV2I	GAAGAC	1 cut(s)	1443
BstX2I	RGATCY	1 cut(s)	603
BstYI	RGATCY	1 cut(s)	603
BstZ17I	GTATAC	1 cut(s)	553
BsuI	GTATCC	2 cut(s)	50, 504
BsuRI	GGCC	6 cut(s)	158, 199, 220, 789, 1232, 1248
BtgI	CCRYGG	2 cut(s)	718, 850
BtgZI	GCGATG	1 cut(s)	1235
BtsCI	GGATG	2 cut(s)	1351, 1392
BveI	ACCTGC	1 cut(s)	1245
Cac8I	GCNNGC	1 cut(s)	357
CciI	TCATGA	1 cut(s)	126
Cfr10I	RCCGGY	1 cut(s)	752
Cfr13I	GGNCC	4 cut(s)	156, 197, 576, 788
CseI	GACGC	1 cut(s)	1120
CspAI	ACCGGT	1 cut(s)	752
CviAII	CATG	9 cut(s)	114, 127, 719, 826, 851, 1228, 1376, 1460, 1500
DdeI	CTNAG	3 cut(s)	725, 809, 1261
DpnI	GATC	8 cut(s)	125, 490, 605, 1011, 1059, 1317, 1333, 1383
DpnII	GATC	8 cut(s)	123, 488, 603, 1009, 1057, 1315, 1331, 1381
EaeI	YGGCCR	1 cut(s)	1230
Eam1104I	CTCTTC	2 cut(s)	1159, 1360
EarI	CTCTTC	2 cut(s)	1159, 1360
Eco130I	CCWWGG	2 cut(s)	718, 850
Eco24I	GRGCYC	1 cut(s)	1397
Eco47I	GGWCC	1 cut(s)	576
Eco88I	CYCGRG	2 cut(s)	657, 1118
EcoO109I	RGGNCCY	1 cut(s)	788
EcoT14I	CCWWGG	2 cut(s)	718, 850
EcoT38I	GRGCYC	1 cut(s)	1397
ErhI	CCWWGG	2 cut(s)	718, 850
Esp3I	CGTCTC	1 cut(s)	1103
FaeI	CATG	9 cut(s)	117, 130, 722, 829, 854, 1231, 1379, 1463, 1503
FaqI	GGGAC	1 cut(s)	29
FatI	CATG	9 cut(s)	113, 126, 718, 825, 850, 1227, 1375, 1459, 1499
FbaI	TGATCA	1 cut(s)	123
FblI	GTMKAC	1 cut(s)	552
Fnu4HI	GCNGC	8 cut(s)	360, 444, 844, 847, 1035, 1083, 1115, 1167
FokI	GGATG	2 cut(s)	1358, 1399
FriOI	GRGCYC	1 cut(s)	1397
Fsp4HI	GCNGC	8 cut(s)	360, 444, 844, 847, 1035, 1083, 1115, 1167
FspBI	CTAG	2 cut(s)	1286, 1326
GluI	GCNGC	8 cut(s)	360, 444, 844, 847, 1035, 1083, 1115, 1167
GsaI	CCCAGC	1 cut(s)	1345
GsuI	CTGGAG	1 cut(s)	1211
HaeIII	GGCC	6 cut(s)	158, 199, 220, 789, 1232, 1248
HapII	CCGG	2 cut(s)	753, 1038
HgaI	GACGC	1 cut(s)	1120
Hin1II	CATG	9 cut(s)	117, 130, 722, 829, 854, 1231, 1379, 1463, 1503
HindIII	AAGCTT	2 cut(s)	266, 761
HinfI	GANTC	5 cut(s)	346, 403, 688, 708, 929
HpaII	CCGG	2 cut(s)	753, 1038
Hpy166II	GTNNAC	2 cut(s)	553, 1323
Hpy188III	TCNNGA	6 cut(s)	103, 127, 416, 458, 1102, 1190
Hpy8I	GTNNAC	2 cut(s)	553, 1323
HpyAV	CCTTC	7 cut(s)	907, 944, 1064, 1134, 1238, 1287, 1360
HpyCH4III	ACNGT	2 cut(s)	1052, 1476
HpyCH4IV	ACGT	1 cut(s)	246
HpyF10VI	GCNNNNNNNGC	4 cut(s)	532, 662, 855, 1120
HpyF3I	CTNAG	3 cut(s)	725, 809, 1261
HpySE526I	ACGT	1 cut(s)	246
Hsp92II	CATG	9 cut(s)	117, 130, 722, 829, 854, 1231, 1379, 1463, 1503
Ksp22I	TGATCA	1 cut(s)	123
Kzo9I	GATC	8 cut(s)	123, 488, 603, 1009, 1057, 1315, 1331, 1381
LmnI	GCTCC	1 cut(s)	1392
Lsp1109I	GCAGC	8 cut(s)	371, 430, 830, 858, 1021, 1069, 1101, 1178
LweI	GCATC	2 cut(s)	643, 692
MaeI	CTAG	2 cut(s)	1286, 1326
MaeII	ACGT	1 cut(s)	246
MaeIII	GTNAC	3 cut(s)	139, 400, 1196
MalI	GATC	8 cut(s)	125, 490, 605, 1011, 1059, 1317, 1333, 1383
MboI	GATC	8 cut(s)	123, 488, 603, 1009, 1057, 1315, 1331, 1381
MboII	GAAGA	9 cut(s)	61, 100, 887, 1074, 1132, 1146, 1347, 1445, 1448
MfeI	CAATTG	2 cut(s)	135, 381
MflI	RGATCY	1 cut(s)	603
MhlI	GDGCHC	2 cut(s)	962, 1397
MlsI	TGGCCA	1 cut(s)	1232
MluCI	AATT	9 cut(s)	83, 96, 135, 233, 257, 381, 712, 771, 1130
MluNI	TGGCCA	1 cut(s)	1232
MlyI	GAGTC	2 cut(s)	397, 717
MmeI	TCCRAC	1 cut(s)	603
Mox20I	TGGCCA	1 cut(s)	1232
MscI	TGGCCA	1 cut(s)	1232
MseI	TTAA	2 cut(s)	474, 776
MslI	CAYNNNNRTG	1 cut(s)	1462
Msp20I	TGGCCA	1 cut(s)	1232
MspA1I	CMGCKG	1 cut(s)	613
MspI	CCGG	2 cut(s)	753, 1038
MunI	CAATTG	2 cut(s)	135, 381
Mva1269I	GAATGC	1 cut(s)	833
MwoI	GCNNNNNNNGC	4 cut(s)	532, 662, 855, 1120
NcoI	CCATGG	2 cut(s)	718, 850
NdeII	GATC	8 cut(s)	123, 488, 603, 1009, 1057, 1315, 1331, 1381
NlaIII	CATG	9 cut(s)	117, 130, 722, 829, 854, 1231, 1379, 1463, 1503
NlaIV	GGNNCC	1 cut(s)	1394
NmuCI	GTSAC	3 cut(s)	139, 400, 1196
NspI	RCATGY	1 cut(s)	829
PaeR7I	CTCGAG	2 cut(s)	657, 1118
PagI	TCATGA	1 cut(s)	126
PciI	ACATGT	1 cut(s)	825
PctI	GAATGC	1 cut(s)	833
PfeI	GAWTC	3 cut(s)	346, 688, 929
PinAI	ACCGGT	1 cut(s)	752
PkrI	GCNGC	8 cut(s)	361, 445, 845, 848, 1036, 1084, 1116, 1168
Ple19I	CGATCG	1 cut(s)	1384
PleI	GAGTC	2 cut(s)	397, 716
PpsI	GAGTC	2 cut(s)	397, 716
PscI	ACATGT	1 cut(s)	825
PsiI	TTATAA	1 cut(s)	303
PspFI	CCCAGC	1 cut(s)	1341
PspN4I	GGNNCC	1 cut(s)	1394
PspPI	GGNCC	4 cut(s)	156, 197, 576, 788
PspXI	VCTCGAGB	2 cut(s)	657, 1118
PstI	CTGCAG	1 cut(s)	848
PsuI	RGATCY	1 cut(s)	603
PvuI	CGATCG	1 cut(s)	1384
RseI	CAYNNNNRTG	1 cut(s)	1462
SaqAI	TTAA	2 cut(s)	474, 776
SatI	GCNGC	8 cut(s)	360, 444, 844, 847, 1035, 1083, 1115, 1167
Sau3AI	GATC	8 cut(s)	123, 488, 603, 1009, 1057, 1315, 1331, 1381
Sau96I	GGNCC	4 cut(s)	156, 197, 576, 788
SchI	GAGTC	2 cut(s)	397, 717
SduI	GDGCHC	2 cut(s)	962, 1397
SfaNI	GCATC	2 cut(s)	643, 692
SfcI	CTRYAG	1 cut(s)	844
Sfr274I	CTCGAG	2 cut(s)	657, 1118
SinI	GGWCC	1 cut(s)	576
SlaI	CTCGAG	2 cut(s)	657, 1118
SmiMI	CAYNNNNRTG	1 cut(s)	1462
SmlI	CTYRAG	3 cut(s)	657, 683, 1118
SmoI	CTYRAG	3 cut(s)	657, 683, 1118
SpeI	ACTAGT	1 cut(s)	1325
Sse9I	AATT	9 cut(s)	83, 96, 135, 233, 257, 381, 712, 771, 1130
SsiI	CCGC	2 cut(s)	164, 611
SspMI	CTAG	2 cut(s)	1286, 1326
StyI	CCWWGG	2 cut(s)	718, 850
TaaI	ACNGT	2 cut(s)	1052, 1476
TaiI	ACGT	1 cut(s)	249
TaqI	TCGA	5 cut(s)	468, 658, 757, 1060, 1119
TasI	AATT	9 cut(s)	83, 96, 135, 233, 257, 381, 712, 771, 1130
TfiI	GAWTC	3 cut(s)	346, 688, 929
Tru1I	TTAA	2 cut(s)	474, 776
Tru9I	TTAA	2 cut(s)	474, 776
TseFI	GTSAC	3 cut(s)	139, 400, 1196
TseI	GCWGC	8 cut(s)	359, 443, 843, 846, 1034, 1082, 1114, 1166
Tsp45I	GTSAC	3 cut(s)	139, 400, 1196
TspDTI	ATGAA	7 cut(s)	122, 472, 587, 794, 831, 953, 1476
VpaK11BI	GGWCC	1 cut(s)	576
XapI	RAATTY	1 cut(s)	771
XceI	RCATGY	1 cut(s)	829
XcmI	CCANNNNNNNNNTGG	2 cut(s)	570, 868
XhoI	CTCGAG	2 cut(s)	657, 1118
XmiI	GTMKAC	1 cut(s)	552
XspI	CTAG	2 cut(s)	1286, 1326

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.