Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000987.1

Orthogroup ID

OG0005587

Physical Location & Seq

Genomic Coordinates Reverse (-)

65690 .. 67325

Gene Structure 1636 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000987.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1002 bp

atgcatggtttggaagctaaccttgaagcagatgtcagcaatatcaagccaatgattaaaagtgtgcatgttgaaggacatgaatgttatgataaatccaatgagtctttacaagtgaactttgatgctagtgatgctggaataaatcaaactacccactcaattggtctggatgataatgataaagatggaaactgtgatgggagtggagagtctggaaaccacagtagaaagagactcatagaagaacatcttgtggcaaatactctagttactgttcaatttgctgatccttatgaaaaccagatctgtctggcagctaacttacacaaagatgatgatgctgggttgaatgagcttgttaagggagatcagcagcttcaatttttcgtaacttctgttattgtgtttgtcatgggaggagcatttacaagtttggagttgctgcaaaatgaatgtcagattgatcaagcaaatgccaaggctattgttgcaagtgctattattcagttgcatttaaatgaagctactgaattgattctatcaaatggcatgagagcttgctataagagtacaaaatttcttgatgatcaggttatctttacaaggttctcatatgggggtctattcgaactttttgcaagtgagtacttttctggctcgatggggccaagtattgcaggagacattggtgtatatggttatagaccctcagttttgaagaatatgcttgcgagttggctatatgtttctttgaggtattgttttcctccagctatcctaatggttactacttttgttctttctgtggcactagttatgtgtgtgactggtcgtggtgtgatgaagactatagaaaaagcacacactgatgaatttgctgagaaagctatgttgctgccatatggaatttctgatgtgggaaaaggatttatatatgatatactttgcttgcaactcttgctggacttggtaagaaaaatgttgcagacttggacatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

333

Amino Acids

36.69

Weight (kDa)

4.84

Isoelectric Point (pI)

28.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005587)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G14190
fragaria_vesca	FvH4_4g12861 FvH4_4g12861
malus_domestica	MD04G1021700.v1.1
prunus_persica	Prupe.1G171300_v2.0.a1 Prupe.1G171300_v2.0.a1
pyrus_communis	pycom04g01780 pycom07g00080
rosa_chinensis	RchiOBHm_Chr4g0412521
rosa_laevigata	RLG00000008282 RLG00000008292
rosa_multiflora	Rmu_sc0000950.1_g000014 Rmu_sc0000987.1_g000016 Rmu_sc0005941.1_g000004
rosa_roxburghii	Rroxscaffold_1G00043460 Rroxscaffold_2G00094110 Rroxscaffold_4G00290720 Rroxscaffold_5G00347880 Rroxscaffold_5G00356740
rosa_rugosa	Rorug04G0103000 Rorug04G0103000 Rorug04G0103100 Rorug04G0103200
rosa_samantha	Rh4AG173700 Rh4BG173200 Rh4CG184700 Rh4DG169200
rosa_wichuraiana	Rw4G014570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	284
AcsI	RAATTY	3 cut(s)	578, 875, 909
AfaI	GTAC	2 cut(s)	574, 650
AgsI	TTSAA	6 cut(s)	26, 74, 281, 352, 383, 721
AhlI	ACTAGT	1 cut(s)	814
AluBI	AGCT	8 cut(s)	17, 320, 358, 379, 527, 560, 776, 890
AluI	AGCT	8 cut(s)	17, 320, 358, 379, 527, 560, 776, 890
Alw26I	GTCTC	2 cut(s)	229, 678
AlwI	GGATC	1 cut(s)	284
AoxI	GGCC	1 cut(s)	668
ApeKI	GCWGC	4 cut(s)	317, 376, 445, 898
ApoI	RAATTY	3 cut(s)	578, 875, 909
ArsI	GACNNNNNNTTYG	2 cut(s)	442, 474
Asp700I	GAANNNNTTC	1 cut(s)	537
AspS9I	GGNCC	1 cut(s)	668
AsuII	TTCGAA	1 cut(s)	630
BbsI	GAAGAC	1 cut(s)	854
BbvI	GCAGC	4 cut(s)	329, 388, 432, 885
BccI	CCATC	3 cut(s)	182, 194, 658
BcgI	CGANNNNNNTGC	2 cut(s)	620, 654
BclI	TGATCA	2 cut(s)	466, 589
BcoDI	GTCTC	2 cut(s)	229, 678
BcuI	ACTAGT	1 cut(s)	814
BfaI	CTAG	3 cut(s)	129, 269, 815
BfmI	CTRYAG	1 cut(s)	852
BglII	AGATCT	1 cut(s)	306
BisI	GCNGC	4 cut(s)	318, 377, 446, 899
BlsI	GCNGC	4 cut(s)	319, 378, 447, 900
BmcAI	AGTACT	1 cut(s)	650
BmgT120I	GGNCC	1 cut(s)	668
BmiI	GGNNCC	1 cut(s)	669
BmsI	GCATC	3 cut(s)	115, 124, 331
BpiI	GAAGAC	1 cut(s)	854
BpmI	CTGGAG	1 cut(s)	756
Bpu14I	TTCGAA	1 cut(s)	630
BsaJI	CCNNGG	1 cut(s)	480
Bse1I	ACTGG	1 cut(s)	835
BseDI	CCNNGG	1 cut(s)	480
BseGI	GGATG	1 cut(s)	178
BseMII	CTCAG	2 cut(s)	726, 873
BseNI	ACTGG	1 cut(s)	835
BseRI	GAGGAG	1 cut(s)	435
BseXI	GCAGC	4 cut(s)	329, 388, 432, 885
BseYI	CCCAGC	1 cut(s)	344
BshFI	GGCC	1 cut(s)	670
BsmAI	GTCTC	2 cut(s)	229, 678
BsnI	GGCC	1 cut(s)	670
Bsp119I	TTCGAA	1 cut(s)	630
Bsp143I	GATC	5 cut(s)	289, 306, 370, 466, 589
BspANI	GGCC	1 cut(s)	670
BspCNI	CTCAG	2 cut(s)	725, 874
BspLI	GGNNCC	1 cut(s)	669
BspPI	GGATC	1 cut(s)	284
BspT104I	TTCGAA	1 cut(s)	630
BsrI	ACTGG	1 cut(s)	835
BssECI	CCNNGG	1 cut(s)	480
BssMI	GATC	5 cut(s)	289, 306, 370, 466, 589
BssT1I	CCWWGG	1 cut(s)	480
Bst4CI	ACNGT	3 cut(s)	197, 227, 277
BstAPI	GCANNNNNTGC	1 cut(s)	961
BstBI	TTCGAA	1 cut(s)	630
BstC8I	GCNNGC	3 cut(s)	562, 732, 953
BstDEI	CTNAG	2 cut(s)	712, 882
BstF5I	GGATG	1 cut(s)	178
BstKTI	GATC	5 cut(s)	292, 309, 373, 469, 592
BstMAI	GTCTC	2 cut(s)	229, 678
BstMBI	GATC	5 cut(s)	289, 306, 370, 466, 589
BstMWI	GCNNNNNNNGC	4 cut(s)	134, 491, 887, 961
BstNSI	RCATGY	1 cut(s)	71
BstSFI	CTRYAG	1 cut(s)	852
BstV1I	GCAGC	4 cut(s)	329, 388, 432, 885
BstV2I	GAAGAC	1 cut(s)	854
BstX2I	RGATCY	1 cut(s)	306
BstXI	CCANNNNNNTGG	1 cut(s)	164
BstYI	RGATCY	1 cut(s)	306
BsuRI	GGCC	1 cut(s)	670
BtsCI	GGATG	1 cut(s)	178
BtsIMutI	CAGTG	1 cut(s)	867
Cac8I	GCNNGC	3 cut(s)	562, 732, 953
Cfr13I	GGNCC	1 cut(s)	668
Csp6I	GTAC	2 cut(s)	573, 649
CviAII	CATG	5 cut(s)	5, 68, 80, 415, 553
CviQI	GTAC	2 cut(s)	573, 649
DdeI	CTNAG	2 cut(s)	712, 882
DpnI	GATC	5 cut(s)	291, 308, 372, 468, 591
DpnII	GATC	5 cut(s)	289, 306, 370, 466, 589
DraI	TTTAAA	1 cut(s)	519
Eco130I	CCWWGG	1 cut(s)	480
EcoT14I	CCWWGG	1 cut(s)	480
EcoT22I	ATGCAT	1 cut(s)	6
ErhI	CCWWGG	1 cut(s)	480
FaeI	CATG	5 cut(s)	8, 71, 83, 418, 556
FalI	AAGNNNNNCTT	3 cut(s)	38, 237, 269
FatI	CATG	5 cut(s)	4, 67, 79, 414, 552
FauNDI	CATATG	2 cut(s)	616, 904
FbaI	TGATCA	2 cut(s)	466, 589
Fnu4HI	GCNGC	4 cut(s)	318, 377, 446, 899
FokI	GGATG	1 cut(s)	185
Fsp4HI	GCNGC	4 cut(s)	318, 377, 446, 899
FspBI	CTAG	3 cut(s)	129, 269, 815
GluI	GCNGC	4 cut(s)	318, 377, 446, 899
GsaI	CCCAGC	1 cut(s)	348
GsuI	CTGGAG	1 cut(s)	756
HaeIII	GGCC	1 cut(s)	670
Hin1II	CATG	5 cut(s)	8, 71, 83, 418, 556
HinfI	GANTC	4 cut(s)	104, 212, 237, 538
Hpy166II	GTNNAC	1 cut(s)	118
Hpy188I	TCNGA	2 cut(s)	462, 916
Hpy188III	TCNNGA	3 cut(s)	170, 216, 584
Hpy8I	GTNNAC	1 cut(s)	118
HpyAV	CCTTC	1 cut(s)	68
HpyCH4III	ACNGT	3 cut(s)	197, 227, 277
HpyCH4V	TGCA	9 cut(s)	4, 67, 448, 494, 514, 641, 680, 955, 988
HpyF10VI	GCNNNNNNNGC	4 cut(s)	134, 491, 887, 961
HpyF3I	CTNAG	2 cut(s)	712, 882
Hsp92II	CATG	5 cut(s)	8, 71, 83, 418, 556
Ksp22I	TGATCA	2 cut(s)	466, 589
Kzo9I	GATC	5 cut(s)	289, 306, 370, 466, 589
LmnI	GCTCC	1 cut(s)	422
Lsp1109I	GCAGC	4 cut(s)	329, 388, 432, 885
LweI	GCATC	3 cut(s)	115, 124, 331
MaeI	CTAG	3 cut(s)	129, 269, 815
MaeIII	GTNAC	4 cut(s)	271, 391, 787, 826
MalI	GATC	5 cut(s)	291, 308, 372, 468, 591
MboI	GATC	5 cut(s)	289, 306, 370, 466, 589
MboII	GAAGA	3 cut(s)	257, 733, 859
MfeI	CAATTG	1 cut(s)	162
MflI	RGATCY	1 cut(s)	306
MluCI	AATT	7 cut(s)	162, 281, 383, 533, 578, 875, 909
MlyI	GAGTC	3 cut(s)	113, 221, 231
MnlI	CCTC	4 cut(s)	413, 721, 750, 780
Mph1103I	ATGCAT	1 cut(s)	6
MroXI	GAANNNNTTC	1 cut(s)	537
MseI	TTAA	3 cut(s)	57, 363, 518
MslI	CAYNNNNRTG	3 cut(s)	333, 519, 870
MunI	CAATTG	1 cut(s)	162
MwoI	GCNNNNNNNGC	4 cut(s)	134, 491, 887, 961
NdeI	CATATG	2 cut(s)	616, 904
NdeII	GATC	5 cut(s)	289, 306, 370, 466, 589
NlaIII	CATG	5 cut(s)	8, 71, 83, 418, 556
NlaIV	GGNNCC	1 cut(s)	669
NmuCI	GTSAC	1 cut(s)	826
NsiI	ATGCAT	1 cut(s)	6
NspI	RCATGY	1 cut(s)	71
NspV	TTCGAA	1 cut(s)	630
PdmI	GAANNNNTTC	1 cut(s)	537
PfeI	GAWTC	1 cut(s)	538
PkrI	GCNGC	4 cut(s)	319, 378, 447, 900
PleI	GAGTC	3 cut(s)	112, 220, 231
PpsI	GAGTC	3 cut(s)	112, 220, 231
PspFI	CCCAGC	1 cut(s)	344
PspN4I	GGNNCC	1 cut(s)	669
PspPI	GGNCC	1 cut(s)	668
PsuI	RGATCY	1 cut(s)	306
RsaI	GTAC	2 cut(s)	574, 650
RsaNI	GTAC	2 cut(s)	573, 649
RseI	CAYNNNNRTG	3 cut(s)	333, 519, 870
SaqAI	TTAA	3 cut(s)	57, 363, 518
SatI	GCNGC	4 cut(s)	318, 377, 446, 899
Sau3AI	GATC	5 cut(s)	289, 306, 370, 466, 589
Sau96I	GGNCC	1 cut(s)	668
ScaI	AGTACT	1 cut(s)	650
SchI	GAGTC	3 cut(s)	113, 221, 231
SfaNI	GCATC	3 cut(s)	115, 124, 331
SfcI	CTRYAG	1 cut(s)	852
SfuI	TTCGAA	1 cut(s)	630
SmiI	ATTTAAAT	1 cut(s)	519
SmiMI	CAYNNNNRTG	3 cut(s)	333, 519, 870
SpeI	ACTAGT	1 cut(s)	814
Sse9I	AATT	7 cut(s)	162, 281, 383, 533, 578, 875, 909
SspMI	CTAG	3 cut(s)	129, 269, 815
StyI	CCWWGG	1 cut(s)	480
SwaI	ATTTAAAT	1 cut(s)	519
TaaI	ACNGT	3 cut(s)	197, 227, 277
TaqI	TCGA	2 cut(s)	630, 662
TasI	AATT	7 cut(s)	162, 281, 383, 533, 578, 875, 909
TatI	WGTACW	2 cut(s)	572, 648
TfiI	GAWTC	1 cut(s)	538
Tru1I	TTAA	3 cut(s)	57, 363, 518
Tru9I	TTAA	3 cut(s)	57, 363, 518
TscAI	CASTG	1 cut(s)	874
TseFI	GTSAC	1 cut(s)	826
TseI	GCWGC	4 cut(s)	317, 376, 445, 898
Tsp45I	GTSAC	1 cut(s)	826
TspDTI	ATGAA	6 cut(s)	96, 312, 468, 537, 860, 888
TspRI	CASTG	1 cut(s)	874
XapI	RAATTY	3 cut(s)	578, 875, 909
XceI	RCATGY	1 cut(s)	71
XmnI	GAANNNNTTC	1 cut(s)	537
XspI	CTAG	3 cut(s)	129, 269, 815
ZrmI	AGTACT	1 cut(s)	650
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.