Rmu_sc0001032.1_g000004

Lipase-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001032.1
Physical Location & Seq
Reverse (-)
14199 .. 18045
3847 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001032.1_g000004.1.cds

Sequence Viewer

Length: 1080 bp
atgatcatggagagaagaaggagatggttgctgttgttggcactacttacttgcctctttgcttcttctgctgggagagaatggaagttcaagcacaaggttcataaccatagccccatctacaatcatacgcttgccacaatattggttcgctatgcctctacggtgtatttgtcagatttgacagagctgttttcttggacatgcgacagatgtgatggcttgattaaggattttcaaatgatagagataattgtggacgtccagcattgcttacaggcatttgttggggtggcaacagatccaaatgctattataattgcatttaaagggactcagggaaacagtatacagaattggatcgaagacttattttggaaacaacttgatatagattaccctggcatgcctgatgcaatggtgcaccatggtttttataatgcttaccacaacacaaccatacgacctggaattctaaatgctgttgcaagagccaaagagttttatggagatattggcatcatagtgacagggcattcaatgggaggggcaatggcttcattttgtgctcttgatttaagggttaatcaaaaggagaataatgttcaagttatgacatttggacaacctcgaatcggtaatgcaatttttgctacttactatagcgaaattctgccacagactatacgagtaacaaatggaaatgatgttgtgcctcatatgcctccatactacacttattttccgcagaagacataccaccacttcccaacggaggtatggctttataacattggattgcgaagtcttgtttatcaggttgagaaaatatgtgatgcctctggtgaggacccaacctgcagcaggtcagtgattggggacagcatttcagaccatttagtttattatggtgtcaaattaatggatgagacatggagaccgtgcaaaattgtgacgggtcctggtttactggatcatggaagatcagatctggaaggaaactttgttctgtccagagatgttgcaactcctgttctcaaattgaaaatacaatcagctgctgggggaaagcctctatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

359

Amino Acids

40.54

Weight (kDa)

6.69

Isoelectric Point (pI)

39.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 3 cut(s) 317, 438, 789
AatII GACGTC 1 cut(s) 264
Acc36I ACCTGC 2 cut(s) 855, 866
AccI GTMKAC 1 cut(s) 349
AciI CCGC 1 cut(s) 746
AclWI GGATC 3 cut(s) 296, 368, 981
AcsI RAATTY 2 cut(s) 471, 669
AcyI GRCGYC 1 cut(s) 261
AfiI CCNNNNNNNGG 3 cut(s) 635, 775, 864
AgsI TTSAA 5 cut(s) 91, 239, 540, 608, 1045
AjnI CCWGG 3 cut(s) 400, 466, 961
AloI GAACNNNNNNTCC 2 cut(s) 990, 1022
AluBI AGCT 2 cut(s) 190, 1058
AluI AGCT 2 cut(s) 190, 1058
Alw21I GWGCWC 2 cut(s) 426, 571
Alw26I GTCTC 2 cut(s) 923, 931
Alw44I GTGCAC 1 cut(s) 422
AlwI GGATC 3 cut(s) 296, 368, 981
AlwNI CAGNNNCTG 1 cut(s) 1061
ApaLI GTGCAC 1 cut(s) 422
ApeKI GCWGC 2 cut(s) 861, 1058
ApoI RAATTY 2 cut(s) 471, 669
AseI ATTAAT 1 cut(s) 920
AspS9I GGNCC 2 cut(s) 850, 959
AsuHPI GGTGA 1 cut(s) 857
AvaII GGWCC 2 cut(s) 850, 959
BaeGI GKGCMC 1 cut(s) 426
BbsI GAAGAC 2 cut(s) 372, 758
Bbv12I GWGCWC 2 cut(s) 426, 571
BbvI GCAGC 2 cut(s) 873, 1045
BccI CCATC 3 cut(s) 18, 125, 212
BciT130I CCWGG 3 cut(s) 402, 468, 963
BclI TGATCA 1 cut(s) 3
BcoDI GTCTC 2 cut(s) 923, 931
BfmI CTRYAG 3 cut(s) 661, 859, 1076
BfuAI ACCTGC 2 cut(s) 855, 866
BglII AGATCT 1 cut(s) 988
BisI GCNGC 2 cut(s) 862, 1059
BlsI GCNGC 2 cut(s) 863, 1060
Bme1390I CCNGG 3 cut(s) 402, 468, 963
Bme18I GGWCC 2 cut(s) 850, 959
BmgT120I GGNCC 2 cut(s) 850, 959
BmiI GGNNCC 2 cut(s) 852, 960
BmrFI CCNGG 3 cut(s) 402, 468, 963
BmsI GCATC 3 cut(s) 403, 528, 826
BpiI GAAGAC 2 cut(s) 372, 758
BsaHI GRCGYC 1 cut(s) 261
BsaI GGTCTC 1 cut(s) 931
BsaJI CCNNGG 2 cut(s) 400, 427
Bsc4I CCNNNNNNNGG 3 cut(s) 635, 775, 864
Bse1I ACTGG 1 cut(s) 975
Bse3DI GCAATG 3 cut(s) 268, 423, 558
BseBI CCWGG 3 cut(s) 402, 468, 963
BseDI CCNNGG 2 cut(s) 400, 427
BseGI GGATG 1 cut(s) 931
BseLI CCNNNNNNNGG 3 cut(s) 635, 775, 864
BseMI GCAATG 3 cut(s) 268, 423, 558
BseMII CTCAG 1 cut(s) 350
BseNI ACTGG 1 cut(s) 975
BseSI GKGCMC 1 cut(s) 426
BseXI GCAGC 2 cut(s) 873, 1045
BseYI CCCAGC 2 cut(s) 71, 1061
BsiHKAI GWGCWC 2 cut(s) 426, 571
BslFI GGGAC 2 cut(s) 346, 893
BslI CCNNNNNNNGG 3 cut(s) 635, 775, 864
BsmAI GTCTC 2 cut(s) 923, 931
BsmFI GGGAC 2 cut(s) 346, 893
BsmI GAATGC 1 cut(s) 535
Bso31I GGTCTC 1 cut(s) 931
Bsp1286I GDGCHC 2 cut(s) 426, 571
Bsp143I GATC 6 cut(s) 3, 301, 360, 973, 983, 988
Bsp19I CCATGG 1 cut(s) 427
BspACI CCGC 1 cut(s) 746
BspCNI CTCAG 1 cut(s) 349
BspLI GGNNCC 2 cut(s) 852, 960
BspMAI CTGCAG 1 cut(s) 863
BspMI ACCTGC 2 cut(s) 855, 866
BspPI GGATC 3 cut(s) 296, 368, 981
BspTNI GGTCTC 1 cut(s) 931
BsrDI GCAATG 3 cut(s) 268, 423, 558
BsrI ACTGG 1 cut(s) 975
BssECI CCNNGG 2 cut(s) 400, 427
BssMI GATC 6 cut(s) 3, 301, 360, 973, 983, 988
BssNAI GTATAC 1 cut(s) 350
BssNI GRCGYC 1 cut(s) 261
BssT1I CCWWGG 1 cut(s) 427
Bst1107I GTATAC 1 cut(s) 350
Bst2UI CCWGG 3 cut(s) 402, 468, 963
Bst4CI ACNGT 3 cut(s) 166, 347, 942
BstACI GRCGYC 1 cut(s) 261
BstAPI GCANNNNNTGC 1 cut(s) 650
BstC8I GCNNGC 2 cut(s) 135, 407
BstDEI CTNAG 1 cut(s) 336
BstDSI CCRYGG 1 cut(s) 427
BstENI CCTNNNNNAGG 1 cut(s) 862
BstF5I GGATG 1 cut(s) 931
BstKTI GATC 6 cut(s) 6, 304, 363, 976, 986, 991
BstMAI GTCTC 2 cut(s) 923, 931
BstMBI GATC 6 cut(s) 3, 301, 360, 973, 983, 988
BstMWI GCNNNNNNNGC 3 cut(s) 68, 650, 721
BstNI CCWGG 3 cut(s) 402, 468, 963
BstNSI RCATGY 2 cut(s) 207, 409
BstSCI CCNGG 3 cut(s) 400, 466, 961
BstSFI CTRYAG 3 cut(s) 661, 859, 1076
BstSLI GKGCMC 1 cut(s) 426
BstV1I GCAGC 2 cut(s) 873, 1045
BstV2I GAAGAC 2 cut(s) 372, 758
BstX2I RGATCY 2 cut(s) 301, 988
BstXI CCANNNNNNTGG 1 cut(s) 145
BstYI RGATCY 2 cut(s) 301, 988
BstZ17I GTATAC 1 cut(s) 350
BtgI CCRYGG 1 cut(s) 427
BtsCI GGATG 1 cut(s) 931
BtsIMutI CAGTG 1 cut(s) 876
BveI ACCTGC 2 cut(s) 855, 866
Cac8I GCNNGC 2 cut(s) 135, 407
CaiI CAGNNNCTG 1 cut(s) 1061
Cfr13I GGNCC 2 cut(s) 850, 959
CviAII CATG 6 cut(s) 7, 204, 406, 428, 933, 977
CviJI RGCY 8 cut(s) 114, 190, 222, 494, 557, 784, 1058, 1072
CviKI_1 RGCY 8 cut(s) 114, 190, 222, 494, 557, 784, 1058, 1072
DdeI CTNAG 1 cut(s) 336
DpnI GATC 6 cut(s) 5, 303, 362, 975, 985, 990
DpnII GATC 6 cut(s) 3, 301, 360, 973, 983, 988
DraI TTTAAA 1 cut(s) 328
Eco130I CCWWGG 1 cut(s) 427
Eco31I GGTCTC 1 cut(s) 931
Eco47I GGWCC 2 cut(s) 850, 959
EcoNI CCTNNNNNAGG 1 cut(s) 862
EcoO109I RGGNCCY 2 cut(s) 850, 959
EcoRI GAATTC 1 cut(s) 471
EcoRII CCWGG 3 cut(s) 400, 466, 961
EcoT14I CCWWGG 1 cut(s) 427
ErhI CCWWGG 1 cut(s) 427
FaeI CATG 6 cut(s) 10, 207, 409, 431, 936, 980
FaqI GGGAC 2 cut(s) 346, 893
FatI CATG 6 cut(s) 6, 203, 405, 427, 932, 976
FauNDI CATATG 1 cut(s) 720
FbaI TGATCA 1 cut(s) 3
FblI GTMKAC 1 cut(s) 349
Fnu4HI GCNGC 2 cut(s) 862, 1059
FokI GGATG 1 cut(s) 938
Fsp4HI GCNGC 2 cut(s) 862, 1059
GluI GCNGC 2 cut(s) 862, 1059
GsaI CCCAGC 2 cut(s) 75, 1065
Hin1I GRCGYC 1 cut(s) 261
Hin1II CATG 6 cut(s) 10, 207, 409, 431, 936, 980
HinfI GANTC 2 cut(s) 334, 633
HphI GGTGA 1 cut(s) 857
Hpy166II GTNNAC 4 cut(s) 259, 350, 424, 968
Hpy188I TCNGA 3 cut(s) 178, 892, 988
Hpy188III TCNNGA 3 cut(s) 572, 992, 1014
Hpy8I GTNNAC 4 cut(s) 259, 350, 424, 968
HpyAV CCTTC 2 cut(s) 12, 989
HpyCH4III ACNGT 3 cut(s) 166, 347, 942
HpyCH4IV ACGT 1 cut(s) 261
HpyCH4V TGCA 8 cut(s) 323, 416, 424, 488, 644, 861, 945, 1025
HpyF10VI GCNNNNNNNGC 3 cut(s) 68, 650, 721
HpyF3I CTNAG 1 cut(s) 336
HpySE526I ACGT 1 cut(s) 261
Hsp92I GRCGYC 1 cut(s) 261
Hsp92II CATG 6 cut(s) 10, 207, 409, 431, 936, 980
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 6 cut(s) 3, 301, 360, 973, 983, 988
Lsp1109I GCAGC 2 cut(s) 873, 1045
LweI GCATC 3 cut(s) 403, 528, 826
MaeII ACGT 1 cut(s) 261
MaeIII GTNAC 3 cut(s) 526, 691, 952
MalI GATC 6 cut(s) 5, 303, 362, 975, 985, 990
MboI GATC 6 cut(s) 3, 301, 360, 973, 983, 988
MboII GAAGA 5 cut(s) 27, 57, 377, 763, 993
MflI RGATCY 2 cut(s) 301, 988
MhlI GDGCHC 2 cut(s) 426, 571
MluCI AATT 9 cut(s) 252, 318, 355, 471, 645, 669, 917, 948, 1040
MlyI GAGTC 1 cut(s) 328
MnlI CCTC 9 cut(s) 65, 169, 539, 639, 726, 735, 769, 841, 850
MseI TTAA 5 cut(s) 228, 327, 578, 585, 920
MslI CAYNNNNRTG 1 cut(s) 524
MspA1I CMGCKG 1 cut(s) 1058
MspR9I CCNGG 3 cut(s) 402, 468, 963
Mva1269I GAATGC 1 cut(s) 535
MvaI CCWGG 3 cut(s) 402, 468, 963
MwoI GCNNNNNNNGC 3 cut(s) 68, 650, 721
NcoI CCATGG 1 cut(s) 427
NdeI CATATG 1 cut(s) 720
NdeII GATC 6 cut(s) 3, 301, 360, 973, 983, 988
NlaIII CATG 6 cut(s) 10, 207, 409, 431, 936, 980
NlaIV GGNNCC 2 cut(s) 852, 960
NmuCI GTSAC 2 cut(s) 526, 952
NspI RCATGY 2 cut(s) 207, 409
PaeI GCATGC 1 cut(s) 409
PctI GAATGC 1 cut(s) 535
PfeI GAWTC 1 cut(s) 633
PkrI GCNGC 2 cut(s) 863, 1060
PleI GAGTC 1 cut(s) 328
PpsI GAGTC 1 cut(s) 328
PpuMI RGGWCCY 2 cut(s) 850, 959
PshBI ATTAAT 1 cut(s) 920
PsiI TTATAA 3 cut(s) 317, 438, 789
Psp5II RGGWCCY 2 cut(s) 850, 959
Psp6I CCWGG 3 cut(s) 400, 466, 961
PspFI CCCAGC 2 cut(s) 71, 1061
PspGI CCWGG 3 cut(s) 400, 466, 961
PspN4I GGNNCC 2 cut(s) 852, 960
PspPI GGNCC 2 cut(s) 850, 959
PspPPI RGGWCCY 2 cut(s) 850, 959
PstI CTGCAG 1 cut(s) 863
PstNI CAGNNNCTG 1 cut(s) 1061
PsuI RGATCY 2 cut(s) 301, 988
PvuII CAGCTG 1 cut(s) 1058
RseI CAYNNNNRTG 1 cut(s) 524
SaqAI TTAA 5 cut(s) 228, 327, 578, 585, 920
SatI GCNGC 2 cut(s) 862, 1059
Sau3AI GATC 6 cut(s) 3, 301, 360, 973, 983, 988
Sau96I GGNCC 2 cut(s) 850, 959
SchI GAGTC 1 cut(s) 328
ScrFI CCNGG 3 cut(s) 402, 468, 963
SduI GDGCHC 2 cut(s) 426, 571
SfaNI GCATC 3 cut(s) 403, 528, 826
SfcI CTRYAG 3 cut(s) 661, 859, 1076
SinI GGWCC 2 cut(s) 850, 959
SmiMI CAYNNNNRTG 1 cut(s) 524
SphI GCATGC 1 cut(s) 409
Sse9I AATT 9 cut(s) 252, 318, 355, 471, 645, 669, 917, 948, 1040
SsiI CCGC 1 cut(s) 746
SspI AATATT 1 cut(s) 144
StyD4I CCNGG 3 cut(s) 400, 466, 961
StyI CCWWGG 1 cut(s) 427
TaaI ACNGT 3 cut(s) 166, 347, 942
TaiI ACGT 1 cut(s) 264
TaqI TCGA 2 cut(s) 363, 631
TasI AATT 9 cut(s) 252, 318, 355, 471, 645, 669, 917, 948, 1040
TfiI GAWTC 1 cut(s) 633
Tru1I TTAA 5 cut(s) 228, 327, 578, 585, 920
Tru9I TTAA 5 cut(s) 228, 327, 578, 585, 920
TscAI CASTG 1 cut(s) 876
TseFI GTSAC 2 cut(s) 526, 952
TseI GCWGC 2 cut(s) 861, 1058
Tsp45I GTSAC 2 cut(s) 526, 952
TspDTI ATGAA 2 cut(s) 92, 549
TspGWI ACGGA 1 cut(s) 788
TspRI CASTG 1 cut(s) 876
VneI GTGCAC 1 cut(s) 422
VpaK11BI GGWCC 2 cut(s) 850, 959
VspI ATTAAT 1 cut(s) 920
XagI CCTNNNNNAGG 1 cut(s) 862
XapI RAATTY 2 cut(s) 471, 669
XceI RCATGY 2 cut(s) 207, 409
XcmI CCANNNNNNNNNTGG 1 cut(s) 777
XmiI GTMKAC 1 cut(s) 349
ZraI GACGTC 1 cut(s) 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.