Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001163.1

Orthogroup ID

OG0003777

Physical Location & Seq

Genomic Coordinates Forward (+)

164577 .. 164918

Gene Structure 342 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001163.1_g000032.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 273 bp

atggccttgtgcaccaccgccttcctctgcaaccacgccactgtattaacctcagcttactcacctcgaaagaccagaaccaccgcaagaagcctccggaggaagctcggcaactcagacctcgaaattagcgaaatcactctgggcacaacgacgtttggtgagcaaaagtcggagaaatctgcctccacgcgtccagatgtgggatccaccgtttctgactggcgatggaccaacgactcaccattgaagctggtgaagtgtgaggactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Aldo_ket_red

Protein Analysis

90

Amino Acids

9.94

Weight (kDa)

8.96

Isoelectric Point (pI)

51.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003777)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G04420
fragaria_vesca	FvH4_4g03680 FvH4_4g03680 FvH4_4g03680 FvH4_4g03680 FvH4_4g03680 FvH4_4g03680
malus_domestica	MD13G1214400.v1.1 MD16G1219600.v1.1
prunus_persica	Prupe.1G039700_v2.0.a1 Prupe.1G039700_v2.0.a1 Prupe.1G040000_v2.0.a1
pyrus_communis	pycom02g18940 pycom13g18800 pycom16g18290
rosa_chinensis	RchiOBHm_Chr4g0393231 RchiOBHm_Chr4g0393291 RchiOBHm_Chr4g0393301
rosa_laevigata	RLG00000009766 RLG00000009769
rosa_multiflora	Rmu_sc0001163.1_g000032 Rmu_sc0001590.1_g000018
rosa_roxburghii	Rroxscaffold_5G00338260 Rroxscaffold_5G00338290
rosa_rugosa	Rorug04G0001900
rosa_samantha	Rh4AG046500 Rh4BG042100 Rh4CG049300 Rh4CG049500 Rh4DG043900 Rh5CG200600 Rh6BG072800
rosa_wichuraiana	Rw4G003650 Rw4G003670

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	193
AccIII	TCCGGA	1 cut(s)	96
AciI	CCGC	2 cut(s)	18, 84
AclWI	GGATC	2 cut(s)	201, 214
AfiI	CCNNNNNNNGG	1 cut(s)	203
AflIII	ACRYGT	1 cut(s)	191
AgsI	TTSAA	1 cut(s)	250
AluBI	AGCT	3 cut(s)	56, 106, 253
AluI	AGCT	3 cut(s)	56, 106, 253
Alw21I	GWGCWC	1 cut(s)	14
Alw44I	GTGCAC	1 cut(s)	10
AlwI	GGATC	2 cut(s)	201, 214
Aor13HI	TCCGGA	1 cut(s)	96
AoxI	GGCC	1 cut(s)	3
ApaLI	GTGCAC	1 cut(s)	10
AspS9I	GGNCC	1 cut(s)	231
AsuHPI	GGTGA	4 cut(s)	54, 173, 234, 268
AvaII	GGWCC	1 cut(s)	231
BaeGI	GKGCMC	2 cut(s)	14, 149
BamHI	GGATCC	1 cut(s)	206
Bbv12I	GWGCWC	1 cut(s)	14
BbvCI	CCTCAGC	1 cut(s)	52
BccI	CCATC	1 cut(s)	222
Bme18I	GGWCC	1 cut(s)	231
BmgT120I	GGNCC	1 cut(s)	231
BmiI	GGNNCC	1 cut(s)	208
Bpu10I	CCTNAGC	1 cut(s)	52
BsaWI	WCCGGW	1 cut(s)	96
Bsc4I	CCNNNNNNNGG	1 cut(s)	203
Bse1I	ACTGG	1 cut(s)	227
BseAI	TCCGGA	1 cut(s)	96
BseLI	CCNNNNNNNGG	1 cut(s)	203
BseMII	CTCAG	2 cut(s)	66, 129
BseNI	ACTGG	1 cut(s)	227
BseSI	GKGCMC	2 cut(s)	14, 149
Bsh1236I	CGCG	1 cut(s)	193
BshFI	GGCC	1 cut(s)	5
BsiHKAI	GWGCWC	1 cut(s)	14
BsiSI	CCGG	1 cut(s)	97
BslI	CCNNNNNNNGG	1 cut(s)	203
BsnI	GGCC	1 cut(s)	5
Bsp1286I	GDGCHC	2 cut(s)	14, 149
Bsp13I	TCCGGA	1 cut(s)	96
Bsp143I	GATC	1 cut(s)	206
BspACI	CCGC	2 cut(s)	18, 84
BspANI	GGCC	1 cut(s)	5
BspCNI	CTCAG	2 cut(s)	65, 128
BspEI	TCCGGA	1 cut(s)	96
BspFNI	CGCG	1 cut(s)	193
BspLI	GGNNCC	1 cut(s)	208
BspPI	GGATC	2 cut(s)	201, 214
BsrI	ACTGG	1 cut(s)	227
BssMI	GATC	1 cut(s)	206
Bst4CI	ACNGT	2 cut(s)	43, 214
BstDEI	CTNAG	2 cut(s)	52, 115
BstFNI	CGCG	1 cut(s)	193
BstKTI	GATC	1 cut(s)	209
BstMBI	GATC	1 cut(s)	206
BstSLI	GKGCMC	2 cut(s)	14, 149
BstUI	CGCG	1 cut(s)	193
BstX2I	RGATCY	1 cut(s)	206
BstYI	RGATCY	1 cut(s)	206
BsuRI	GGCC	1 cut(s)	5
BtgZI	GCGATG	1 cut(s)	241
BtsIMutI	CAGTG	1 cut(s)	39
Cfr13I	GGNCC	1 cut(s)	231
CseI	GACGC	1 cut(s)	182
CviJI	RGCY	5 cut(s)	5, 56, 93, 106, 253
CviKI_1	RGCY	5 cut(s)	5, 56, 93, 106, 253
DdeI	CTNAG	2 cut(s)	52, 115
DpnI	GATC	1 cut(s)	208
DpnII	GATC	1 cut(s)	206
Eco47I	GGWCC	1 cut(s)	231
HaeIII	GGCC	1 cut(s)	5
HapII	CCGG	1 cut(s)	97
HgaI	GACGC	1 cut(s)	182
HinfI	GANTC	1 cut(s)	239
HpaII	CCGG	1 cut(s)	97
HphI	GGTGA	4 cut(s)	54, 173, 234, 268
Hpy166II	GTNNAC	1 cut(s)	12
Hpy188I	TCNGA	3 cut(s)	118, 175, 220
Hpy188III	TCNNGA	2 cut(s)	97, 197
Hpy8I	GTNNAC	1 cut(s)	12
Hpy99I	CGWCG	1 cut(s)	157
HpyAV	CCTTC	1 cut(s)	31
HpyCH4III	ACNGT	2 cut(s)	43, 214
HpyCH4IV	ACGT	1 cut(s)	155
HpyCH4V	TGCA	2 cut(s)	12, 30
HpyF3I	CTNAG	2 cut(s)	52, 115
HpySE526I	ACGT	1 cut(s)	155
Kpn2I	TCCGGA	1 cut(s)	96
Kzo9I	GATC	1 cut(s)	206
LpnPI	CCDG	6 cut(s)	88, 110, 128, 208, 210, 239
MaeII	ACGT	1 cut(s)	155
MalI	GATC	1 cut(s)	208
MboI	GATC	1 cut(s)	206
MflI	RGATCY	1 cut(s)	206
MhlI	GDGCHC	2 cut(s)	14, 149
MluCI	AATT	1 cut(s)	126
MluI	ACGCGT	1 cut(s)	191
MlyI	GAGTC	1 cut(s)	233
MmeI	TCCRAC	1 cut(s)	153
MnlI	CCTC	8 cut(s)	35, 61, 75, 93, 104, 131, 196, 259
MroI	TCCGGA	1 cut(s)	96
MseI	TTAA	1 cut(s)	47
MspI	CCGG	1 cut(s)	97
MvnI	CGCG	1 cut(s)	193
NdeII	GATC	1 cut(s)	206
NlaIV	GGNNCC	1 cut(s)	208
NmeAIII	GCCGAG	1 cut(s)	87
PcsI	WCGNNNNNNNCGW	1 cut(s)	129
PleI	GAGTC	1 cut(s)	233
PpsI	GAGTC	1 cut(s)	233
PspN4I	GGNNCC	1 cut(s)	208
PspPI	GGNCC	1 cut(s)	231
PsuI	RGATCY	1 cut(s)	206
SaqAI	TTAA	1 cut(s)	47
Sau3AI	GATC	1 cut(s)	206
Sau96I	GGNCC	1 cut(s)	231
SchI	GAGTC	1 cut(s)	233
SduI	GDGCHC	2 cut(s)	14, 149
SetI	ASST	7 cut(s)	53, 58, 67, 108, 123, 158, 255
SinI	GGWCC	1 cut(s)	231
Sse9I	AATT	1 cut(s)	126
SsiI	CCGC	2 cut(s)	18, 84
TaaI	ACNGT	2 cut(s)	43, 214
TaiI	ACGT	1 cut(s)	158
TaqI	TCGA	2 cut(s)	67, 123
TasI	AATT	1 cut(s)	126
Tru1I	TTAA	1 cut(s)	47
Tru9I	TTAA	1 cut(s)	47
TscAI	CASTG	1 cut(s)	46
TspRI	CASTG	1 cut(s)	46
VneI	GTGCAC	1 cut(s)	10
VpaK11BI	GGWCC	1 cut(s)	231

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.