Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001192.1

Orthogroup ID

OG0005543

Physical Location & Seq

Genomic Coordinates Forward (+)

217000 .. 217455

Gene Structure 456 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001192.1_g000046.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 456 bp

atggagatcagtatcatttccagagacaccatcaaaccatcgctcgattcctcttcacttaaccatttaagtcctttcaaactttccctcatcgaccagctgactcccgcaacttatatgccactgatcttgttctaccccattagtgatcccaagtcatcgttcaatctcctcgaaaccctaacccgcttaaaaagctccctctccgagactctcactctctactatccattttcgggacgggctaaaaacaacctcgacattcatgactttgacaccggtattcccttccttgaagcccgagtcaattgtcgcatgctcgagtttcttaagctccaagaaactgagttgctgaaccttttcgttccattccatcccatttgcaaggaaactggtgatgagtctctgctccccatgctagcttttcaagtgaatatctttgcttgtggtgaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0006807 GO:0008150 GO:0008152 GO:0009820 GO:0016740 GO:0016746 GO:0016747 GO:0050636 GO:0071704 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko00940 ko00941 ko00945 ko01100 ko01110 map00940 map00941 map00945 map01100 map01110

Pfam Domains

Protein Families

Transferase

Protein Analysis

151

Amino Acids

17.15

Weight (kDa)

5.01

Isoelectric Point (pI)

47.84

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005543)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g06720
rosa_chinensis	RchiOBHm_Chr1g0362371 RchiOBHm_Chr1g0362381
rosa_laevigata	RLG00000008114 RLG00000008115 RLG00000018584
rosa_multiflora	Rmu_co8190972.1_g000001 Rmu_sc0001192.1_g000046 Rmu_sc0003260.1_g000002 Rmu_sc0003260.1_g000003 Rmu_sc0013178.1_g000003 Rmu_sc0013947.1_g000004 Rmu_sc0013947.1_g000005
rosa_roxburghii	Rroxscaffold_2G00122880 Rroxscaffold_4G00294220 Rroxscaffold_5G00355160
rosa_rugosa	Rorug01G0297800 Rorug01G0297800 Rorug04G0114800
rosa_samantha	Rh1AG306700 Rh1CG287700 Rh1DG300500 Rh4AG188900 Rh4AG189000 Rh4DG155800 Rh4DG187800
rosa_wichuraiana	Rw1G027250 Rw4G013470 Rw4G016120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	108, 187
AclWI	GGATC	1 cut(s)	143
AfiI	CCNNNNNNNGG	1 cut(s)	236
AflII	CTTAAG	1 cut(s)	329
AgeI	ACCGGT	1 cut(s)	278
AgsI	TTSAA	4 cut(s)	79, 166, 296, 428
AjuI	GAANNNNNNNTTGG	2 cut(s)	146, 178
AluBI	AGCT	4 cut(s)	100, 198, 334, 422
AluI	AGCT	4 cut(s)	100, 198, 334, 422
Alw26I	GTCTC	3 cut(s)	18, 203, 408
AlwI	GGATC	1 cut(s)	143
Ama87I	CYCGRG	2 cut(s)	300, 320
AsiGI	ACCGGT	1 cut(s)	278
Asp700I	GAANNNNTTC	1 cut(s)	359
AsuHPI	GGTGA	1 cut(s)	407
AsuNHI	GCTAGC	1 cut(s)	418
AvaI	CYCGRG	2 cut(s)	300, 320
BccI	CCATC	3 cut(s)	38, 46, 381
BcoDI	GTCTC	3 cut(s)	18, 203, 408
BfaI	CTAG	1 cut(s)	419
BfrI	CTTAAG	1 cut(s)	329
BmeT110I	CYCGRG	2 cut(s)	300, 320
BmtI	GCTAGC	1 cut(s)	422
BsaBI	GATNNNNATC	1 cut(s)	11
BsaWI	WCCGGW	1 cut(s)	278
Bsc4I	CCNNNNNNNGG	1 cut(s)	236
Bse118I	RCCGGY	1 cut(s)	278
Bse1I	ACTGG	1 cut(s)	397
Bse8I	GATNNNNATC	1 cut(s)	11
BseGI	GGATG	1 cut(s)	373
BseJI	GATNNNNATC	1 cut(s)	11
BseLI	CCNNNNNNNGG	1 cut(s)	236
BseMII	CTCAG	1 cut(s)	336
BseNI	ACTGG	1 cut(s)	397
BseRI	GAGGAG	1 cut(s)	161
BshTI	ACCGGT	1 cut(s)	278
BsiHKCI	CYCGRG	2 cut(s)	300, 320
BsiSI	CCGG	1 cut(s)	279
BslFI	GGGAC	1 cut(s)	252
BslI	CCNNNNNNNGG	1 cut(s)	236
BsmAI	GTCTC	3 cut(s)	18, 203, 408
BsmFI	GGGAC	1 cut(s)	252
BsoBI	CYCGRG	2 cut(s)	300, 320
Bsp143I	GATC	3 cut(s)	6, 126, 148
BspACI	CCGC	2 cut(s)	108, 187
BspCNI	CTCAG	1 cut(s)	337
BspHI	TCATGA	1 cut(s)	265
BspOI	GCTAGC	1 cut(s)	422
BspPI	GGATC	1 cut(s)	143
BspTI	CTTAAG	1 cut(s)	329
BsrFI	RCCGGY	1 cut(s)	278
BsrI	ACTGG	1 cut(s)	397
BssAI	RCCGGY	1 cut(s)	278
BssMI	GATC	3 cut(s)	6, 126, 148
Bst6I	CTCTTC	1 cut(s)	58
BstAFI	CTTAAG	1 cut(s)	329
BstC8I	GCNNGC	2 cut(s)	317, 420
BstDEI	CTNAG	1 cut(s)	345
BstF5I	GGATG	1 cut(s)	373
BstKTI	GATC	3 cut(s)	9, 129, 151
BstMAI	GTCTC	3 cut(s)	18, 203, 408
BstMBI	GATC	3 cut(s)	6, 126, 148
BstMWI	GCNNNNNNNGC	2 cut(s)	195, 415
BstNSI	RCATGY	1 cut(s)	319
BtgZI	GCGATG	1 cut(s)	24
BtsCI	GGATG	1 cut(s)	373
BtsIMutI	CAGTG	1 cut(s)	122
Cac8I	GCNNGC	2 cut(s)	317, 420
CciI	TCATGA	1 cut(s)	265
Cfr10I	RCCGGY	1 cut(s)	278
CspAI	ACCGGT	1 cut(s)	278
CspCI	CAANNNNNGTGG	2 cut(s)	111, 146
CviAII	CATG	3 cut(s)	266, 316, 415
CviJI	RGCY	6 cut(s)	100, 198, 245, 299, 334, 422
CviKI_1	RGCY	6 cut(s)	100, 198, 245, 299, 334, 422
DdeI	CTNAG	1 cut(s)	345
DpnI	GATC	3 cut(s)	8, 128, 150
DpnII	GATC	3 cut(s)	6, 126, 148
Eam1104I	CTCTTC	1 cut(s)	58
EarI	CTCTTC	1 cut(s)	58
Eco88I	CYCGRG	2 cut(s)	300, 320
FaeI	CATG	3 cut(s)	269, 319, 418
FaiI	YATR	5 cut(s)	117, 119, 267, 317, 416
FaqI	GGGAC	1 cut(s)	252
FatI	CATG	3 cut(s)	265, 315, 414
FauI	CCCGC	2 cut(s)	115, 194
FokI	GGATG	1 cut(s)	360
FspBI	CTAG	1 cut(s)	419
HapII	CCGG	1 cut(s)	279
Hin1II	CATG	3 cut(s)	269, 319, 418
HinfI	GANTC	5 cut(s)	47, 103, 211, 303, 401
HpaII	CCGG	1 cut(s)	279
HphI	GGTGA	1 cut(s)	407
Hpy188I	TCNGA	1 cut(s)	208
Hpy188III	TCNNGA	3 cut(s)	21, 237, 266
HpyAV	CCTTC	1 cut(s)	298
HpyCH4V	TGCA	1 cut(s)	384
HpyF10VI	GCNNNNNNNGC	2 cut(s)	195, 415
HpyF3I	CTNAG	1 cut(s)	345
Hsp92II	CATG	3 cut(s)	269, 319, 418
Kzo9I	GATC	3 cut(s)	6, 126, 148
LmnI	GCTCC	3 cut(s)	203, 339, 414
LpnPI	CCDG	4 cut(s)	34, 110, 292, 378
MaeI	CTAG	1 cut(s)	419
MalI	GATC	3 cut(s)	8, 128, 150
MboI	GATC	3 cut(s)	6, 126, 148
MboII	GAAGA	1 cut(s)	45
MfeI	CAATTG	1 cut(s)	307
MluCI	AATT	1 cut(s)	307
MlyI	GAGTC	4 cut(s)	97, 205, 312, 410
MnlI	CCTC	5 cut(s)	61, 98, 182, 212, 266
MroXI	GAANNNNTTC	1 cut(s)	359
MseI	TTAA	4 cut(s)	60, 68, 191, 330
MspA1I	CMGCKG	1 cut(s)	100
MspCI	CTTAAG	1 cut(s)	329
MspI	CCGG	1 cut(s)	279
MunI	CAATTG	1 cut(s)	307
MwoI	GCNNNNNNNGC	2 cut(s)	195, 415
NdeII	GATC	3 cut(s)	6, 126, 148
NheI	GCTAGC	1 cut(s)	418
NlaIII	CATG	3 cut(s)	269, 319, 418
NspI	RCATGY	1 cut(s)	319
PaeI	GCATGC	1 cut(s)	319
PaeR7I	CTCGAG	1 cut(s)	320
PagI	TCATGA	1 cut(s)	265
PdmI	GAANNNNTTC	1 cut(s)	359
PfeI	GAWTC	1 cut(s)	47
PinAI	ACCGGT	1 cut(s)	278
PleI	GAGTC	4 cut(s)	97, 205, 311, 409
PpsI	GAGTC	4 cut(s)	97, 205, 311, 409
PspXI	VCTCGAGB	1 cut(s)	320
PvuII	CAGCTG	1 cut(s)	100
SaqAI	TTAA	4 cut(s)	60, 68, 191, 330
Sau3AI	GATC	3 cut(s)	6, 126, 148
SchI	GAGTC	4 cut(s)	97, 205, 312, 410
SetI	ASST	6 cut(s)	102, 200, 258, 336, 360, 424
Sfr274I	CTCGAG	1 cut(s)	320
SlaI	CTCGAG	1 cut(s)	320
SmlI	CTYRAG	2 cut(s)	320, 329
SmoI	CTYRAG	2 cut(s)	320, 329
SphI	GCATGC	1 cut(s)	319
Sse9I	AATT	1 cut(s)	307
SsiI	CCGC	2 cut(s)	108, 187
SspMI	CTAG	1 cut(s)	419
TaqI	TCGA	5 cut(s)	45, 93, 174, 258, 321
TasI	AATT	1 cut(s)	307
TfiI	GAWTC	1 cut(s)	47
Tru1I	TTAA	4 cut(s)	60, 68, 191, 330
Tru9I	TTAA	4 cut(s)	60, 68, 191, 330
TscAI	CASTG	1 cut(s)	129
TspDTI	ATGAA	1 cut(s)	254
TspRI	CASTG	1 cut(s)	129
Vha464I	CTTAAG	1 cut(s)	329
XceI	RCATGY	1 cut(s)	319
XhoI	CTCGAG	1 cut(s)	320
XmnI	GAANNNNTTC	1 cut(s)	359
XspI	CTAG	1 cut(s)	419

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.