Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003260.1

Orthogroup ID

OG0005543

Physical Location & Seq

Genomic Coordinates Reverse (-)

21541 .. 22265

Gene Structure 725 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003260.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 576 bp

atggcttcttcttgggcactgtcaccaggttcctcaccaagaacttccatagtagcgcatgcaatgaacatgagatcaaggatgaagccacaaacatcgtcagctaatatcgttggaaatttattttggtgggcgacaacagtcgcggacacatctaagctaggggaagatcatgagttatgtgacttggtgcacctgattaatgaatctcttaaaggatttgataggggttattttgagtcttttcagggagaagagggatttggagccatttcaaaatactttaatcaactagaagtcttgctttcttcaaaatccccaccagaactttatttattcaccaattggacaagcatttttcacaaattgaattttggatgggggaagcctttctgggtagggctcatggggaaagtcgggcctgagtttaggaatttcacggtgttcatggaagcaccatgtggtaaaggaattgaagcgtgggtgacattggaggcaaagcaaatggctctgctccaaaaagaccttaagtttctagcatttgcttctccaaaatctgggatttcaagcatgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0006807 GO:0008150 GO:0008152 GO:0009820 GO:0016740 GO:0016746 GO:0016747 GO:0050636 GO:0071704 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko00940 ko00941 ko00945 ko01100 ko01110 map00940 map00941 map00945 map01100 map01110

Pfam Domains

Protein Families

Transferase

Protein Analysis

191

Amino Acids

21.3

Weight (kDa)

7.78

Isoelectric Point (pI)

29.41

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005543)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g06720
rosa_chinensis	RchiOBHm_Chr1g0362371 RchiOBHm_Chr1g0362381
rosa_laevigata	RLG00000008114 RLG00000008115 RLG00000018584
rosa_multiflora	Rmu_co8190972.1_g000001 Rmu_sc0001192.1_g000046 Rmu_sc0003260.1_g000002 Rmu_sc0003260.1_g000003 Rmu_sc0013178.1_g000003 Rmu_sc0013947.1_g000004 Rmu_sc0013947.1_g000005
rosa_roxburghii	Rroxscaffold_2G00122880 Rroxscaffold_4G00294220 Rroxscaffold_5G00355160
rosa_rugosa	Rorug01G0297800 Rorug01G0297800 Rorug04G0114800
rosa_samantha	Rh1AG306700 Rh1CG287700 Rh1DG300500 Rh4AG188900 Rh4AG189000 Rh4DG155800 Rh4DG187800
rosa_wichuraiana	Rw1G027250 Rw4G013470 Rw4G016120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	557
AccII	CGCG	1 cut(s)	146
AciI	CCGC	1 cut(s)	146
AcsI	RAATTY	3 cut(s)	118, 370, 433
AdeI	CACNNNGTG	1 cut(s)	461
AfiI	CCNNNNNNNGG	1 cut(s)	557
AflII	CTTAAG	1 cut(s)	527
AgsI	TTSAA	5 cut(s)	276, 312, 370, 476, 567
AjnI	CCWGG	1 cut(s)	25
AjuI	GAANNNNNNNTTGG	4 cut(s)	109, 141, 246, 278
AluBI	AGCT	2 cut(s)	104, 160
AluI	AGCT	2 cut(s)	104, 160
Alw21I	GWGCWC	1 cut(s)	195
Alw44I	GTGCAC	1 cut(s)	191
AoxI	GGCC	1 cut(s)	419
ApaLI	GTGCAC	1 cut(s)	191
ApoI	RAATTY	3 cut(s)	118, 370, 433
AseI	ATTAAT	1 cut(s)	201
Asp700I	GAANNNNTTC	1 cut(s)	389
AspLEI	GCGC	1 cut(s)	58
AspS9I	GGNCC	1 cut(s)	419
AsuHPI	GGTGA	4 cut(s)	15, 27, 331, 496
BaeGI	GKGCMC	2 cut(s)	19, 195
BanII	GRGCYC	1 cut(s)	405
Bbv12I	GWGCWC	1 cut(s)	195
BccI	CCATC	1 cut(s)	372
BciT130I	CCWGG	1 cut(s)	27
BfaI	CTAG	3 cut(s)	161, 293, 536
BfrI	CTTAAG	1 cut(s)	527
Bme1390I	CCNGG	1 cut(s)	27
BmgT120I	GGNCC	1 cut(s)	419
BmiI	GGNNCC	2 cut(s)	31, 268
BmrFI	CCNGG	1 cut(s)	27
BoxI	GACNNNNGTC	1 cut(s)	140
Bsc4I	CCNNNNNNNGG	1 cut(s)	557
Bse3DI	GCAATG	1 cut(s)	69
BseBI	CCWGG	1 cut(s)	27
BseGI	GGATG	2 cut(s)	87, 383
BseLI	CCNNNNNNNGG	1 cut(s)	557
BseMI	GCAATG	1 cut(s)	69
BseMII	CTCAG	1 cut(s)	414
BseSI	GKGCMC	2 cut(s)	19, 195
Bsh1236I	CGCG	1 cut(s)	146
BshFI	GGCC	1 cut(s)	421
BsiHKAI	GWGCWC	1 cut(s)	195
BslI	CCNNNNNNNGG	1 cut(s)	557
BsnI	GGCC	1 cut(s)	421
Bsp1286I	GDGCHC	3 cut(s)	19, 195, 405
Bsp143I	GATC	2 cut(s)	74, 169
BspACI	CCGC	1 cut(s)	146
BspANI	GGCC	1 cut(s)	421
BspCNI	CTCAG	1 cut(s)	415
BspFNI	CGCG	1 cut(s)	146
BspHI	TCATGA	1 cut(s)	172
BspLI	GGNNCC	2 cut(s)	31, 268
BspTI	CTTAAG	1 cut(s)	527
BsrDI	GCAATG	1 cut(s)	69
BssMI	GATC	2 cut(s)	74, 169
Bst2UI	CCWGG	1 cut(s)	27
Bst4CI	ACNGT	3 cut(s)	21, 142, 442
Bst6I	CTCTTC	1 cut(s)	249
BstAFI	CTTAAG	1 cut(s)	527
BstC8I	GCNNGC	1 cut(s)	60
BstDEI	CTNAG	2 cut(s)	156, 423
BstF5I	GGATG	2 cut(s)	87, 383
BstFNI	CGCG	1 cut(s)	146
BstHHI	GCGC	1 cut(s)	58
BstKTI	GATC	2 cut(s)	77, 172
BstMBI	GATC	2 cut(s)	74, 169
BstNI	CCWGG	1 cut(s)	27
BstNSI	RCATGY	2 cut(s)	62, 574
BstPAI	GACNNNNGTC	1 cut(s)	140
BstSCI	CCNGG	1 cut(s)	25
BstSLI	GKGCMC	2 cut(s)	19, 195
BstUI	CGCG	1 cut(s)	146
BsuRI	GGCC	1 cut(s)	421
BtsCI	GGATG	2 cut(s)	87, 383
BtsIMutI	CAGTG	1 cut(s)	17
Cac8I	GCNNGC	1 cut(s)	60
CciI	TCATGA	1 cut(s)	172
CfoI	GCGC	1 cut(s)	58
Cfr13I	GGNCC	1 cut(s)	419
CsiI	ACCWGGT	1 cut(s)	25
CviAII	CATG	7 cut(s)	59, 70, 173, 406, 448, 459, 571
CviJI	RGCY	9 cut(s)	5, 88, 104, 160, 269, 388, 403, 421, 509
CviKI_1	RGCY	9 cut(s)	5, 88, 104, 160, 269, 388, 403, 421, 509
DdeI	CTNAG	2 cut(s)	156, 423
DpnI	GATC	2 cut(s)	76, 171
DpnII	GATC	2 cut(s)	74, 169
DraIII	CACNNNGTG	1 cut(s)	461
Eam1104I	CTCTTC	1 cut(s)	249
EarI	CTCTTC	1 cut(s)	249
Eco24I	GRGCYC	1 cut(s)	405
EcoRII	CCWGG	1 cut(s)	25
EcoT38I	GRGCYC	1 cut(s)	405
FaeI	CATG	7 cut(s)	62, 73, 176, 409, 451, 462, 574
FaiI	YATR	9 cut(s)	50, 60, 71, 174, 181, 407, 449, 460, 572
FalI	AAGNNNNNCTT	2 cut(s)	288, 320
FatI	CATG	7 cut(s)	58, 69, 172, 405, 447, 458, 570
FokI	GGATG	2 cut(s)	94, 390
FriOI	GRGCYC	1 cut(s)	405
FspBI	CTAG	3 cut(s)	161, 293, 536
GlaI	GCGC	1 cut(s)	57
HaeIII	GGCC	1 cut(s)	421
HhaI	GCGC	1 cut(s)	58
Hin1II	CATG	7 cut(s)	62, 73, 176, 409, 451, 462, 574
Hin6I	GCGC	1 cut(s)	56
HinP1I	GCGC	1 cut(s)	56
HinfI	GANTC	2 cut(s)	206, 239
HphI	GGTGA	4 cut(s)	15, 27, 331, 496
Hpy166II	GTNNAC	1 cut(s)	193
Hpy188III	TCNNGA	1 cut(s)	173
Hpy8I	GTNNAC	1 cut(s)	193
HpyCH4III	ACNGT	3 cut(s)	21, 142, 442
HpyCH4V	TGCA	2 cut(s)	62, 193
HpyF3I	CTNAG	2 cut(s)	156, 423
Hsp92II	CATG	7 cut(s)	62, 73, 176, 409, 451, 462, 574
HspAI	GCGC	1 cut(s)	56
Kzo9I	GATC	2 cut(s)	74, 169
LmnI	GCTCC	2 cut(s)	266, 519
LpnPI	CCDG	8 cut(s)	12, 39, 209, 233, 336, 379, 435, 543
MabI	ACCWGGT	1 cut(s)	25
MaeI	CTAG	3 cut(s)	161, 293, 536
MaeIII	GTNAC	3 cut(s)	21, 182, 484
MalI	GATC	2 cut(s)	76, 171
MboI	GATC	2 cut(s)	74, 169
MboII	GAAGA	3 cut(s)	179, 266, 300
MfeI	CAATTG	1 cut(s)	343
MhlI	GDGCHC	3 cut(s)	19, 195, 405
MluCI	AATT	6 cut(s)	118, 343, 365, 370, 433, 471
MlyI	GAGTC	1 cut(s)	248
MmeI	TCCRAC	1 cut(s)	94
MnlI	CCTC	3 cut(s)	43, 250, 487
MroXI	GAANNNNTTC	1 cut(s)	389
MseI	TTAA	4 cut(s)	201, 213, 285, 528
MspCI	CTTAAG	1 cut(s)	527
MspR9I	CCNGG	1 cut(s)	27
MunI	CAATTG	1 cut(s)	343
MvaI	CCWGG	1 cut(s)	27
MvnI	CGCG	1 cut(s)	146
NdeII	GATC	2 cut(s)	74, 169
NlaIII	CATG	7 cut(s)	62, 73, 176, 409, 451, 462, 574
NlaIV	GGNNCC	2 cut(s)	31, 268
NmuCI	GTSAC	3 cut(s)	21, 182, 484
NspI	RCATGY	2 cut(s)	62, 574
PaeI	GCATGC	1 cut(s)	62
PagI	TCATGA	1 cut(s)	172
PdmI	GAANNNNTTC	1 cut(s)	389
PfeI	GAWTC	1 cut(s)	206
PflMI	CCANNNNNTGG	1 cut(s)	557
PleI	GAGTC	1 cut(s)	247
PpsI	GAGTC	1 cut(s)	247
PshAI	GACNNNNGTC	1 cut(s)	140
PshBI	ATTAAT	1 cut(s)	201
Psp6I	CCWGG	1 cut(s)	25
PspGI	CCWGG	1 cut(s)	25
PspN4I	GGNNCC	2 cut(s)	31, 268
PspPI	GGNCC	1 cut(s)	419
SaqAI	TTAA	4 cut(s)	201, 213, 285, 528
Sau3AI	GATC	2 cut(s)	74, 169
Sau96I	GGNCC	1 cut(s)	419
SchI	GAGTC	1 cut(s)	248
ScrFI	CCNGG	1 cut(s)	27
SduI	GDGCHC	3 cut(s)	19, 195, 405
SetI	ASST	5 cut(s)	31, 106, 162, 198, 528
SexAI	ACCWGGT	1 cut(s)	25
SmlI	CTYRAG	1 cut(s)	527
SmoI	CTYRAG	1 cut(s)	527
SphI	GCATGC	1 cut(s)	62
Sse9I	AATT	6 cut(s)	118, 343, 365, 370, 433, 471
SsiI	CCGC	1 cut(s)	146
SspMI	CTAG	3 cut(s)	161, 293, 536
StyD4I	CCNGG	1 cut(s)	25
TaaI	ACNGT	3 cut(s)	21, 142, 442
TasI	AATT	6 cut(s)	118, 343, 365, 370, 433, 471
TfiI	GAWTC	1 cut(s)	206
Tru1I	TTAA	4 cut(s)	201, 213, 285, 528
Tru9I	TTAA	4 cut(s)	201, 213, 285, 528
TscAI	CASTG	1 cut(s)	24
TseFI	GTSAC	3 cut(s)	21, 182, 484
Tsp45I	GTSAC	3 cut(s)	21, 182, 484
TspDTI	ATGAA	4 cut(s)	80, 98, 219, 436
TspRI	CASTG	1 cut(s)	24
Van91I	CCANNNNNTGG	1 cut(s)	557
Vha464I	CTTAAG	1 cut(s)	527
VneI	GTGCAC	1 cut(s)	191
VspI	ATTAAT	1 cut(s)	201
XapI	RAATTY	3 cut(s)	118, 370, 433
XceI	RCATGY	2 cut(s)	62, 574
XmnI	GAANNNNTTC	1 cut(s)	389
XspI	CTAG	3 cut(s)	161, 293, 536

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.