Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001333.1

Orthogroup ID

OG0003492

Physical Location & Seq

Genomic Coordinates Reverse (-)

12492 .. 13466

Gene Structure 975 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001333.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 255 bp

atgctagccattgattcaagccatgtaatatacccttgttttcaagataaggaaggcatccctcctgatcagcagagattgatttttgccggtaagcaattggaagatggcagaactcttgcagattataacatccaaaatgagtcaactcttcacctggttttgaggctgaggggaggaactatgattaaggtgaaggctcttaccgagaaacaaattgagattgatattgaaccgactgacaccattgactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ubiquitin

Protein Analysis

84

Amino Acids

9.51

Weight (kDa)

4.85

Isoelectric Point (pI)

49.3

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003492)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G31340 AT2G35635
fragaria_vesca	FvH4_3g15350 FvH4_6g21361
malus_domestica	MD10G1205300.v1.1 MD12G1050500.v1.1 MD14G1049000.v1.1
prunus_persica	Prupe.4G136400_v2.0.a1 Prupe.7G086300_v2.0.a1
pyrus_communis	pycom10g17580 pycom12g04500 pycom14g04010
rosa_chinensis	RchiOBHm_Chr0c32g0501481 RchiOBHm_Chr3g0477981 RchiOBHm_Chr3g0478131 RchiOBHm_Chr3g0478171 RchiOBHm_Chr3g0478321 RchiOBHm_Chr3g0478371 RchiOBHm_Chr3g0483791 RchiOBHm_Chr4g0426431
rosa_laevigata	RLG00000032875
rosa_multiflora	Rmu_sc0001218.1_g000001 Rmu_sc0001333.1_g000004 Rmu_sc0005657.1_g000008
rosa_roxburghii	Rroxscaffold_6G00403390
rosa_rugosa	Rorug03G0165100 Rorug05G0088500
rosa_samantha	Rh3AG215400 Rh3AG215900
rosa_wichuraiana	Rw0G010130 Rw3G019400 Rw3G019430 Rw3G019480 Rw4G023230 Rw5G016380

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	129
AgsI	TTSAA	3 cut(s)	18, 44, 233
AjnI	CCWGG	1 cut(s)	156
AsuHPI	GGTGA	2 cut(s)	146, 205
AsuNHI	GCTAGC	1 cut(s)	4
BbvCI	CCTCAGC	1 cut(s)	170
BccI	CCATC	1 cut(s)	101
BciT130I	CCWGG	1 cut(s)	158
BclI	TGATCA	1 cut(s)	67
BfaI	CTAG	1 cut(s)	5
Bme1390I	CCNGG	1 cut(s)	158
BmrFI	CCNGG	1 cut(s)	158
BmsI	GCATC	1 cut(s)	66
BmtI	GCTAGC	1 cut(s)	8
Bpu10I	CCTNAGC	1 cut(s)	170
Bse118I	RCCGGY	1 cut(s)	89
BseBI	CCWGG	1 cut(s)	158
BseGI	GGATG	2 cut(s)	57, 132
BseMII	CTCAG	1 cut(s)	161
BsiSI	CCGG	1 cut(s)	90
Bsp143I	GATC	1 cut(s)	67
BspCNI	CTCAG	1 cut(s)	162
BspOI	GCTAGC	1 cut(s)	8
BsrFI	RCCGGY	1 cut(s)	89
BssAI	RCCGGY	1 cut(s)	89
BssMI	GATC	1 cut(s)	67
Bst2UI	CCWGG	1 cut(s)	158
Bst6I	CTCTTC	1 cut(s)	156
BstC8I	GCNNGC	1 cut(s)	6
BstDEI	CTNAG	1 cut(s)	170
BstF5I	GGATG	2 cut(s)	57, 132
BstKTI	GATC	1 cut(s)	70
BstMBI	GATC	1 cut(s)	67
BstNI	CCWGG	1 cut(s)	158
BstSCI	CCNGG	1 cut(s)	156
BtsCI	GGATG	2 cut(s)	57, 132
Cac8I	GCNNGC	1 cut(s)	6
Cfr10I	RCCGGY	1 cut(s)	89
CsiI	ACCWGGT	1 cut(s)	156
CviAII	CATG	1 cut(s)	23
CviJI	RGCY	4 cut(s)	8, 21, 169, 200
CviKI_1	RGCY	4 cut(s)	8, 21, 169, 200
DdeI	CTNAG	1 cut(s)	170
DpnI	GATC	1 cut(s)	69
DpnII	GATC	1 cut(s)	67
Eam1104I	CTCTTC	1 cut(s)	156
EarI	CTCTTC	1 cut(s)	156
EcoRII	CCWGG	1 cut(s)	156
FaeI	CATG	1 cut(s)	26
FaiI	YATR	4 cut(s)	24, 31, 129, 185
FatI	CATG	1 cut(s)	22
FbaI	TGATCA	1 cut(s)	67
FokI	GGATG	2 cut(s)	44, 119
FspBI	CTAG	1 cut(s)	5
HapII	CCGG	1 cut(s)	90
Hin1II	CATG	1 cut(s)	26
HincII	GTYRAC	1 cut(s)	147
HindII	GTYRAC	1 cut(s)	147
HinfI	GANTC	2 cut(s)	14, 143
HpaII	CCGG	1 cut(s)	90
HphI	GGTGA	2 cut(s)	146, 205
Hpy166II	GTNNAC	1 cut(s)	147
Hpy188III	TCNNGA	2 cut(s)	44, 65
Hpy8I	GTNNAC	1 cut(s)	147
HpyAV	CCTTC	2 cut(s)	47, 190
HpyCH4V	TGCA	1 cut(s)	122
HpyF3I	CTNAG	1 cut(s)	170
Hsp92II	CATG	1 cut(s)	26
Ksp22I	TGATCA	1 cut(s)	67
Kzo9I	GATC	1 cut(s)	67
LpnPI	CCDG	4 cut(s)	78, 103, 143, 170
LweI	GCATC	1 cut(s)	66
MabI	ACCWGGT	1 cut(s)	156
MaeI	CTAG	1 cut(s)	5
MalI	GATC	1 cut(s)	69
MboI	GATC	1 cut(s)	67
MboII	GAAGA	2 cut(s)	116, 143
MfeI	CAATTG	1 cut(s)	98
MluCI	AATT	2 cut(s)	98, 216
MlyI	GAGTC	1 cut(s)	152
MnlI	CCTC	4 cut(s)	72, 159, 165, 170
MseI	TTAA	1 cut(s)	189
MspI	CCGG	1 cut(s)	90
MspR9I	CCNGG	1 cut(s)	158
MunI	CAATTG	1 cut(s)	98
MvaI	CCWGG	1 cut(s)	158
NdeII	GATC	1 cut(s)	67
NheI	GCTAGC	1 cut(s)	4
NlaIII	CATG	1 cut(s)	26
PfeI	GAWTC	1 cut(s)	14
PleI	GAGTC	1 cut(s)	151
PpsI	GAGTC	1 cut(s)	151
PsiI	TTATAA	1 cut(s)	129
Psp6I	CCWGG	1 cut(s)	156
PspGI	CCWGG	1 cut(s)	156
SaqAI	TTAA	1 cut(s)	189
Sau3AI	GATC	1 cut(s)	67
SchI	GAGTC	1 cut(s)	152
ScrFI	CCNGG	1 cut(s)	158
SetI	ASST	2 cut(s)	159, 195
SexAI	ACCWGGT	1 cut(s)	156
SfaNI	GCATC	1 cut(s)	66
Sse9I	AATT	2 cut(s)	98, 216
SspMI	CTAG	1 cut(s)	5
StyD4I	CCNGG	1 cut(s)	156
TasI	AATT	2 cut(s)	98, 216
TfiI	GAWTC	1 cut(s)	14
Tru1I	TTAA	1 cut(s)	189
Tru9I	TTAA	1 cut(s)	189
XspI	CTAG	1 cut(s)	5

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.