Rmu_sc0005657.1_g000008

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked Lys-48-linked is involved in protein degradation via the proteasome

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005657.1
Physical Location & Seq
Reverse (-)
57302 .. 58160
859 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005657.1_g000008.1.cds

Sequence Viewer

Length: 300 bp
atgcttcacctggttttgaggctgtggggaggaactatgattaaggtgaagactcttaccgggaaagaaattgagattgatattgaaccgactgacaccattaaccgaatcaaggaaagtgttgaggtgaaagagggaattcctccggtgcaacaaagagtgacagaaaggggactgatggttctggcttttgccgcacagagaaaactacttctgtcttttaattcgaggcagaggaaagtgtttagagcggtagggttgaataattatgggtcttgggtattggagattgatgattag

Protein Analysis

99

Amino Acids

11.32

Weight (kDa)

9.52

Isoelectric Point (pI)

30.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 251
AciI CCGC 2 cut(s) 195, 251
AcsI RAATTY 1 cut(s) 138
AfiI CCNNNNNNNGG 1 cut(s) 112
AgsI TTSAA 2 cut(s) 86, 262
AjnI CCWGG 1 cut(s) 9
AloI GAACNNNNNNTCC 2 cut(s) 165, 197
ApoI RAATTY 1 cut(s) 138
AsuC2I CCSGG 1 cut(s) 61
AsuHPI GGTGA 2 cut(s) 58, 139
BbsI GAAGAC 1 cut(s) 56
BccI CCATC 1 cut(s) 172
BciT130I CCWGG 1 cut(s) 11
BcnI CCSGG 1 cut(s) 61
BisI GCNGC 1 cut(s) 195
BlsI GCNGC 1 cut(s) 196
Bme1390I CCNGG 2 cut(s) 11, 61
BmrFI CCNGG 2 cut(s) 11, 61
BpiI GAAGAC 1 cut(s) 56
BpuMI CCSGG 1 cut(s) 61
BsaWI WCCGGW 1 cut(s) 145
Bsc4I CCNNNNNNNGG 1 cut(s) 112
BseBI CCWGG 1 cut(s) 11
BseLI CCNNNNNNNGG 1 cut(s) 112
BsiSI CCGG 2 cut(s) 60, 146
BslFI GGGAC 1 cut(s) 186
BslI CCNNNNNNNGG 1 cut(s) 112
BsmFI GGGAC 1 cut(s) 186
BspACI CCGC 2 cut(s) 195, 251
BsrBI CCGCTC 1 cut(s) 251
Bst2UI CCWGG 1 cut(s) 11
BstMWI GCNNNNNNNGC 1 cut(s) 194
BstNI CCWGG 1 cut(s) 11
BstSCI CCNGG 2 cut(s) 9, 59
BstV2I GAAGAC 1 cut(s) 56
CsiI ACCWGGT 1 cut(s) 9
CviJI RGCY 2 cut(s) 22, 188
CviKI_1 RGCY 2 cut(s) 22, 188
EcoRI GAATTC 1 cut(s) 138
EcoRII CCWGG 1 cut(s) 9
FaiI YATR 2 cut(s) 38, 270
FaqI GGGAC 1 cut(s) 186
Fnu4HI GCNGC 1 cut(s) 195
Fsp4HI GCNGC 1 cut(s) 195
GluI GCNGC 1 cut(s) 195
HapII CCGG 2 cut(s) 60, 146
HinfI GANTC 2 cut(s) 52, 108
HpaII CCGG 2 cut(s) 60, 146
HphI GGTGA 2 cut(s) 58, 139
HpyCH4V TGCA 1 cut(s) 151
HpyF10VI GCNNNNNNNGC 1 cut(s) 194
LpnPI CCDG 4 cut(s) 23, 73, 159, 170
MabI ACCWGGT 1 cut(s) 9
MaeIII GTNAC 1 cut(s) 160
MbiI CCGCTC 1 cut(s) 251
MboII GAAGA 1 cut(s) 61
MluCI AATT 4 cut(s) 69, 138, 223, 265
MlyI GAGTC 1 cut(s) 46
MnlI CCTC 7 cut(s) 12, 23, 118, 127, 153, 222, 228
MseI TTAA 3 cut(s) 42, 102, 222
MspI CCGG 2 cut(s) 60, 146
MspR9I CCNGG 2 cut(s) 11, 61
MvaI CCWGG 1 cut(s) 11
MwoI GCNNNNNNNGC 1 cut(s) 194
NciI CCSGG 1 cut(s) 61
NmuCI GTSAC 1 cut(s) 160
PfeI GAWTC 1 cut(s) 108
PkrI GCNGC 1 cut(s) 196
PleI GAGTC 1 cut(s) 46
PpsI GAGTC 1 cut(s) 46
Psp6I CCWGG 1 cut(s) 9
PspGI CCWGG 1 cut(s) 9
SaqAI TTAA 3 cut(s) 42, 102, 222
SatI GCNGC 1 cut(s) 195
SchI GAGTC 1 cut(s) 46
ScrFI CCNGG 2 cut(s) 11, 61
SetI ASST 3 cut(s) 12, 48, 129
SexAI ACCWGGT 1 cut(s) 9
SgeI CNNG 9 cut(s) 22, 23, 72, 73, 124, 158, 197, 240, 288
Sse9I AATT 4 cut(s) 69, 138, 223, 265
SsiI CCGC 2 cut(s) 195, 251
StyD4I CCNGG 2 cut(s) 9, 59
TaqI TCGA 1 cut(s) 227
TasI AATT 4 cut(s) 69, 138, 223, 265
TauI GCSGC 1 cut(s) 197
TfiI GAWTC 1 cut(s) 108
Tru1I TTAA 3 cut(s) 42, 102, 222
Tru9I TTAA 3 cut(s) 42, 102, 222
TseFI GTSAC 1 cut(s) 160
Tsp45I GTSAC 1 cut(s) 160
XapI RAATTY 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.