Rmu_sc0003071.1_g000007

Clathrin assembly protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003071.1
OG0004817
Physical Location & Seq
Reverse (-)
17731 .. 18442
712 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003071.1_g000007.1.cds

Sequence Viewer

Length: 333 bp
atgcaggaggatctcttagagaagggagaggatgatatccatcgacacgctgatcaacctgcggctcaacctcaagcaaatggaacaggttgggaattggcacttgttacagccccaagctcaaatgagagtgctacagctgctagcaaactggcgggagggttggacttgcttacactagacagcctatattatgatgcaattagaagaaacaatcaaaatgtaagctataacccatgggagcaggctcccatgaatggtggcatgatgcaacaaccaattcatgatcccttttatgcatccaacatagtggccgcaccaccctctgtatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ANTH

Protein Analysis

110

Amino Acids

11.91

Weight (kDa)

4.36

Isoelectric Point (pI)

58.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 67
AciI CCGC 3 cut(s) 62, 155, 315
AclWI GGATC 2 cut(s) 18, 281
AcoI YGGCCR 1 cut(s) 312
AfiI CCNNNNNNNGG 1 cut(s) 257
AluBI AGCT 3 cut(s) 120, 140, 228
AluI AGCT 3 cut(s) 120, 140, 228
AlwI GGATC 2 cut(s) 18, 281
AoxI GGCC 1 cut(s) 312
ApeKI GCWGC 1 cut(s) 140
AsuNHI GCTAGC 1 cut(s) 143
BbvI GCAGC 1 cut(s) 127
BccI CCATC 1 cut(s) 48
BclI TGATCA 1 cut(s) 52
BfaI CTAG 2 cut(s) 144, 179
BfmI CTRYAG 1 cut(s) 135
BfuAI ACCTGC 1 cut(s) 67
BisI GCNGC 3 cut(s) 63, 141, 315
BlsI GCNGC 3 cut(s) 64, 142, 316
BmiI GGNNCC 1 cut(s) 249
BmsI GCATC 3 cut(s) 187, 258, 308
BmtI GCTAGC 1 cut(s) 147
BpuEI CTTGAG 1 cut(s) 57
BsaBI GATNNNNATC 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 236
Bsc4I CCNNNNNNNGG 1 cut(s) 257
Bse1I ACTGG 1 cut(s) 156
Bse8I GATNNNNATC 1 cut(s) 39
BseDI CCNNGG 1 cut(s) 236
BseGI GGATG 2 cut(s) 37, 299
BseJI GATNNNNATC 1 cut(s) 39
BseLI CCNNNNNNNGG 1 cut(s) 257
BseNI ACTGG 1 cut(s) 156
BseXI GCAGC 1 cut(s) 127
BshFI GGCC 1 cut(s) 314
BslI CCNNNNNNNGG 1 cut(s) 257
BsnI GGCC 1 cut(s) 314
Bsp143I GATC 3 cut(s) 10, 52, 286
Bsp19I CCATGG 1 cut(s) 236
BspACI CCGC 3 cut(s) 62, 155, 315
BspANI GGCC 1 cut(s) 314
BspHI TCATGA 1 cut(s) 283
BspLI GGNNCC 1 cut(s) 249
BspMI ACCTGC 1 cut(s) 67
BspOI GCTAGC 1 cut(s) 147
BspPI GGATC 2 cut(s) 18, 281
BsrI ACTGG 1 cut(s) 156
BssECI CCNNGG 1 cut(s) 236
BssMI GATC 3 cut(s) 10, 52, 286
BssT1I CCWWGG 1 cut(s) 236
BstC8I GCNNGC 2 cut(s) 145, 246
BstDEI CTNAG 1 cut(s) 16
BstDSI CCRYGG 1 cut(s) 236
BstF5I GGATG 2 cut(s) 37, 299
BstKTI GATC 3 cut(s) 13, 55, 289
BstMBI GATC 3 cut(s) 10, 52, 286
BstMWI GCNNNNNNNGC 1 cut(s) 140
BstSFI CTRYAG 1 cut(s) 135
BstV1I GCAGC 1 cut(s) 127
BstX2I RGATCY 1 cut(s) 10
BstXI CCANNNNNNTGG 1 cut(s) 310
BstYI RGATCY 1 cut(s) 10
BsuRI GGCC 1 cut(s) 314
BtgI CCRYGG 1 cut(s) 236
BtsCI GGATG 2 cut(s) 37, 299
BveI ACCTGC 1 cut(s) 67
Cac8I GCNNGC 2 cut(s) 145, 246
CciI TCATGA 1 cut(s) 283
CviAII CATG 4 cut(s) 237, 253, 265, 284
CviJI RGCY 8 cut(s) 65, 113, 120, 140, 186, 228, 248, 314
CviKI_1 RGCY 8 cut(s) 65, 113, 120, 140, 186, 228, 248, 314
DdeI CTNAG 1 cut(s) 16
DpnI GATC 3 cut(s) 12, 54, 288
DpnII GATC 3 cut(s) 10, 52, 286
EaeI YGGCCR 1 cut(s) 312
Eco130I CCWWGG 1 cut(s) 236
Eco32I GATATC 1 cut(s) 37
EcoRV GATATC 1 cut(s) 37
EcoT14I CCWWGG 1 cut(s) 236
EcoT22I ATGCAT 1 cut(s) 301
ErhI CCWWGG 1 cut(s) 236
FaeI CATG 4 cut(s) 240, 256, 268, 287
FatI CATG 4 cut(s) 236, 252, 264, 283
FauI CCCGC 1 cut(s) 148
FbaI TGATCA 1 cut(s) 52
Fnu4HI GCNGC 3 cut(s) 63, 141, 315
FokI GGATG 2 cut(s) 44, 286
Fsp4HI GCNGC 3 cut(s) 63, 141, 315
FspBI CTAG 2 cut(s) 144, 179
GluI GCNGC 3 cut(s) 63, 141, 315
HaeIII GGCC 1 cut(s) 314
Hin1II CATG 4 cut(s) 240, 256, 268, 287
Hpy188III TCNNGA 1 cut(s) 284
HpyAV CCTTC 1 cut(s) 16
HpyCH4V TGCA 4 cut(s) 4, 200, 271, 299
HpyF10VI GCNNNNNNNGC 1 cut(s) 140
HpyF3I CTNAG 1 cut(s) 16
Hsp92II CATG 4 cut(s) 240, 256, 268, 287
Ksp22I TGATCA 1 cut(s) 52
Kzo9I GATC 3 cut(s) 10, 52, 286
LmnI GCTCC 2 cut(s) 241, 253
LpnPI CCDG 4 cut(s) 72, 72, 137, 230
Lsp1109I GCAGC 1 cut(s) 127
LweI GCATC 3 cut(s) 187, 258, 308
MaeI CTAG 2 cut(s) 144, 179
MaeIII GTNAC 1 cut(s) 106
MalI GATC 3 cut(s) 12, 54, 288
MboI GATC 3 cut(s) 10, 52, 286
MboII GAAGA 1 cut(s) 219
MflI RGATCY 1 cut(s) 10
MluCI AATT 3 cut(s) 95, 201, 279
MmeI TCCRAC 2 cut(s) 144, 327
MnlI CCTC 3 cut(s) 22, 81, 152
Mph1103I ATGCAT 1 cut(s) 301
MspA1I CMGCKG 1 cut(s) 140
MwoI GCNNNNNNNGC 1 cut(s) 140
NcoI CCATGG 1 cut(s) 236
NdeII GATC 3 cut(s) 10, 52, 286
NheI GCTAGC 1 cut(s) 143
NlaIII CATG 4 cut(s) 240, 256, 268, 287
NlaIV GGNNCC 1 cut(s) 249
NsiI ATGCAT 1 cut(s) 301
PagI TCATGA 1 cut(s) 283
PkrI GCNGC 3 cut(s) 64, 142, 316
PspN4I GGNNCC 1 cut(s) 249
PsuI RGATCY 1 cut(s) 10
PvuII CAGCTG 1 cut(s) 140
SatI GCNGC 3 cut(s) 63, 141, 315
Sau3AI GATC 3 cut(s) 10, 52, 286
SetI ASST 6 cut(s) 61, 73, 91, 122, 142, 230
SfaNI GCATC 3 cut(s) 187, 258, 308
SfcI CTRYAG 1 cut(s) 135
SmlI CTYRAG 1 cut(s) 72
SmoI CTYRAG 1 cut(s) 72
Sse9I AATT 3 cut(s) 95, 201, 279
SsiI CCGC 3 cut(s) 62, 155, 315
SspMI CTAG 2 cut(s) 144, 179
StyI CCWWGG 1 cut(s) 236
TaqI TCGA 1 cut(s) 43
TasI AATT 3 cut(s) 95, 201, 279
TauI GCSGC 2 cut(s) 65, 317
TseI GCWGC 1 cut(s) 140
TspDTI ATGAA 2 cut(s) 269, 272
XspI CTAG 2 cut(s) 144, 179
Zsp2I ATGCAT 1 cut(s) 301
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.