Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2D

Orthogroup ID

OG0004817

Physical Location & Seq

Genomic Coordinates Reverse (-)

72585235 .. 72587386

Gene Structure 2152 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2DG503600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 366 bp

ATGGAAGAGTACGTCAGAGAAGCTCCTCGTGTCTCAATAGTTCGCAAGGAGGTGATTGACAATAAAATTTCTGCCCCCAAGGAAATCTTGGCCATAGAGGACAAAAAGACCCAAGACGATGAGGCACGTCCACCTTCCCCACCTCCACCTAAACCAGTAAAAGTGGTAGCACCTGTAGTTGAACCACTTGATTTGCTGGGTTTGAATGATCCTGTTCCAGATACTGCAGCATTAGATGAGAAGAATGCCATGGCTTTAGCTATTGTTCCCATATGTTGTTGTGGTGATCAAGAAATAAAAAAGGTTTCTTTAACAAGGCCATGTACCAAAGCAAGGTTAGCTAACATTGATGGCGTCGACAACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ANTH

Protein Analysis

121

Amino Acids

13.15

Weight (kDa)

4.9

Isoelectric Point (pI)

53.45

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004817)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G35200 AT5G35200
fragaria_vesca	FvH4_1g02540 FvH4_1g02540 FvH4_1g02540
malus_domestica	MD02G1022900.v1.1 MD15G1165600.v1.1
prunus_persica	Prupe.7G249200_v2.0.a1 Prupe.7G249200_v2.0.a1
pyrus_communis	pycom15g14840
rosa_chinensis	RchiOBHm_Chr1g0354531 RchiOBHm_Chr2g0087571
rosa_laevigata	RLG00000015879
rosa_multiflora	Rmu_co7995458.1_g000001 Rmu_sc0002299.1_g000024 Rmu_sc0003071.1_g000007 Rmu_sc0006059.1_g000023
rosa_roxburghii	Rroxscaffold_2G00153460
rosa_rugosa	Rorug01G0476600 Rorug06G0009000
rosa_samantha	Rh2AG030100 Rh2AG444300 Rh2BG030000 Rh2CG030300 Rh2CG431200 Rh2DG030200 Rh2DG503600 Rh4AG121800
rosa_wichuraiana	Rw1G014010 Rw2G002390 Rw5G022520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	357
AclWI	GGATC	1 cut(s)	203
AcoI	YGGCCR	1 cut(s)	90
AcsI	RAATTY	1 cut(s)	66
AcyI	GRCGYC	1 cut(s)	354
AfaI	GTAC	2 cut(s)	11, 325
AfiI	CCNNNNNNNGG	1 cut(s)	333
AgsI	TTSAA	2 cut(s)	182, 205
AjiI	CACGTC	1 cut(s)	128
AluBI	AGCT	3 cut(s)	23, 260, 341
AluI	AGCT	3 cut(s)	23, 260, 341
Alw26I	GTCTC	1 cut(s)	37
AlwI	GGATC	1 cut(s)	203
AlwNI	CAGNNNCTG	1 cut(s)	224
AoxI	GGCC	2 cut(s)	90, 317
ApeKI	GCWGC	1 cut(s)	227
ApoI	RAATTY	1 cut(s)	66
AsuHPI	GGTGA	2 cut(s)	64, 296
BalI	TGGCCA	1 cut(s)	92
BauI	CACGAG	1 cut(s)	27
BbvI	GCAGC	1 cut(s)	239
BccI	CCATC	1 cut(s)	344
BclI	TGATCA	1 cut(s)	286
BcoDI	GTCTC	1 cut(s)	37
BfaI	CTAG	1 cut(s)	364
BfmI	CTRYAG	2 cut(s)	174, 225
BisI	GCNGC	1 cut(s)	228
BlsI	GCNGC	1 cut(s)	229
BmgBI	CACGTC	1 cut(s)	128
BsaHI	GRCGYC	1 cut(s)	354
BsaJI	CCNNGG	2 cut(s)	78, 249
Bsc4I	CCNNNNNNNGG	1 cut(s)	333
Bse1I	ACTGG	1 cut(s)	155
BseDI	CCNNGG	2 cut(s)	78, 249
BseLI	CCNNNNNNNGG	1 cut(s)	333
BseNI	ACTGG	1 cut(s)	155
BseRI	GAGGAG	1 cut(s)	15
BseXI	GCAGC	1 cut(s)	239
BseYI	CCCAGC	1 cut(s)	196
BshFI	GGCC	2 cut(s)	92, 319
BslI	CCNNNNNNNGG	1 cut(s)	333
BsmAI	GTCTC	1 cut(s)	37
BsmI	GAATGC	1 cut(s)	250
BsnI	GGCC	2 cut(s)	92, 319
Bsp143I	GATC	2 cut(s)	208, 286
Bsp19I	CCATGG	1 cut(s)	249
BspANI	GGCC	2 cut(s)	92, 319
BspMAI	CTGCAG	1 cut(s)	229
BspPI	GGATC	1 cut(s)	203
BsrI	ACTGG	1 cut(s)	155
BssECI	CCNNGG	2 cut(s)	78, 249
BssMI	GATC	2 cut(s)	208, 286
BssNI	GRCGYC	1 cut(s)	354
BssSI	CACGAG	1 cut(s)	27
BssT1I	CCWWGG	2 cut(s)	78, 249
Bst2BI	CACGAG	1 cut(s)	27
BstACI	GRCGYC	1 cut(s)	354
BstDSI	CCRYGG	1 cut(s)	249
BstKTI	GATC	2 cut(s)	211, 289
BstMAI	GTCTC	1 cut(s)	37
BstMBI	GATC	2 cut(s)	208, 286
BstMWI	GCNNNNNNNGC	1 cut(s)	338
BstSFI	CTRYAG	2 cut(s)	174, 225
BstV1I	GCAGC	1 cut(s)	239
BsuRI	GGCC	2 cut(s)	92, 319
BtgI	CCRYGG	1 cut(s)	249
BtrI	CACGTC	1 cut(s)	128
CaiI	CAGNNNCTG	1 cut(s)	224
CseI	GACGC	1 cut(s)	343
Csp6I	GTAC	2 cut(s)	10, 324
CspCI	CAANNNNNGTGG	2 cut(s)	174, 209
CviAII	CATG	2 cut(s)	250, 321
CviJI	RGCY	6 cut(s)	23, 92, 254, 260, 319, 341
CviKI_1	RGCY	6 cut(s)	23, 92, 254, 260, 319, 341
CviQI	GTAC	2 cut(s)	10, 324
DpnI	GATC	2 cut(s)	210, 288
DpnII	GATC	2 cut(s)	208, 286
EaeI	YGGCCR	1 cut(s)	90
Eco130I	CCWWGG	2 cut(s)	78, 249
EcoT14I	CCWWGG	2 cut(s)	78, 249
ErhI	CCWWGG	2 cut(s)	78, 249
FaeI	CATG	2 cut(s)	253, 324
FaiI	YATR	5 cut(s)	95, 251, 272, 274, 322
FalI	AAGNNNNNCTT	2 cut(s)	71, 103
FatI	CATG	2 cut(s)	249, 320
FauNDI	CATATG	1 cut(s)	272
FbaI	TGATCA	1 cut(s)	286
FblI	GTMKAC	1 cut(s)	357
Fnu4HI	GCNGC	1 cut(s)	228
Fsp4HI	GCNGC	1 cut(s)	228
FspBI	CTAG	1 cut(s)	364
GluI	GCNGC	1 cut(s)	228
GsaI	CCCAGC	1 cut(s)	200
HaeIII	GGCC	2 cut(s)	92, 319
HgaI	GACGC	1 cut(s)	343
Hin1I	GRCGYC	1 cut(s)	354
Hin1II	CATG	2 cut(s)	253, 324
HincII	GTYRAC	1 cut(s)	358
HindII	GTYRAC	1 cut(s)	358
HphI	GGTGA	2 cut(s)	64, 296
Hpy166II	GTNNAC	2 cut(s)	131, 358
Hpy188I	TCNGA	1 cut(s)	17
Hpy188III	TCNNGA	2 cut(s)	218, 290
Hpy8I	GTNNAC	2 cut(s)	131, 358
Hpy99I	CGWCG	1 cut(s)	359
HpyAV	CCTTC	1 cut(s)	144
HpyCH4IV	ACGT	2 cut(s)	12, 127
HpyCH4V	TGCA	1 cut(s)	227
HpyF10VI	GCNNNNNNNGC	1 cut(s)	338
HpySE526I	ACGT	2 cut(s)	12, 127
Hsp92I	GRCGYC	1 cut(s)	354
Hsp92II	CATG	2 cut(s)	253, 324
Ksp22I	TGATCA	1 cut(s)	286
Kzo9I	GATC	2 cut(s)	208, 286
LmnI	GCTCC	1 cut(s)	28
LpnPI	CCDG	5 cut(s)	168, 182, 186, 225, 231
Lsp1109I	GCAGC	1 cut(s)	239
MaeI	CTAG	1 cut(s)	364
MaeII	ACGT	2 cut(s)	12, 127
MalI	GATC	2 cut(s)	210, 288
MboI	GATC	2 cut(s)	208, 286
MboII	GAAGA	2 cut(s)	17, 253
MlsI	TGGCCA	1 cut(s)	92
MluCI	AATT	1 cut(s)	66
MluNI	TGGCCA	1 cut(s)	92
MnlI	CCTC	5 cut(s)	36, 43, 91, 115, 153
Mox20I	TGGCCA	1 cut(s)	92
MscI	TGGCCA	1 cut(s)	92
MseI	TTAA	1 cut(s)	311
Msp20I	TGGCCA	1 cut(s)	92
Mva1269I	GAATGC	1 cut(s)	250
MwoI	GCNNNNNNNGC	1 cut(s)	338
NcoI	CCATGG	1 cut(s)	249
NdeI	CATATG	1 cut(s)	272
NdeII	GATC	2 cut(s)	208, 286
NlaIII	CATG	2 cut(s)	253, 324
PctI	GAATGC	1 cut(s)	250
PkrI	GCNGC	1 cut(s)	229
PspFI	CCCAGC	1 cut(s)	196
PstI	CTGCAG	1 cut(s)	229
PstNI	CAGNNNCTG	1 cut(s)	224
RsaI	GTAC	2 cut(s)	11, 325
RsaNI	GTAC	2 cut(s)	10, 324
SalI	GTCGAC	1 cut(s)	356
SaqAI	TTAA	1 cut(s)	311
SatI	GCNGC	1 cut(s)	228
Sau3AI	GATC	2 cut(s)	208, 286
SfcI	CTRYAG	2 cut(s)	174, 225
Sse9I	AATT	1 cut(s)	66
SspMI	CTAG	1 cut(s)	364
StyI	CCWWGG	2 cut(s)	78, 249
TaiI	ACGT	2 cut(s)	15, 130
TaqI	TCGA	1 cut(s)	357
TasI	AATT	1 cut(s)	66
Tru1I	TTAA	1 cut(s)	311
Tru9I	TTAA	1 cut(s)	311
TseI	GCWGC	1 cut(s)	227
XapI	RAATTY	1 cut(s)	66
XcmI	CCANNNNNNNNNTGG	1 cut(s)	85
XmiI	GTMKAC	1 cut(s)	357
XspI	CTAG	1 cut(s)	364

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.