Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003371.1

Orthogroup ID

OG0008163

Physical Location & Seq

Genomic Coordinates Forward (+)

13605 .. 13931

Gene Structure 327 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003371.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 225 bp

atgggattggaatatattccaaccattgaggaaatggctttctttgaagaggttgaaaaagaaaaagcagatgaagatagaaaagcaaaggagcaagcagctgcattggctgaacagattgttgccactcaacaaagcaagaatgctacaaaggtttccaaagtttcaaaggcaagtgatgcttcaaaaagttcaaagactagaaacactaacaaaaagaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

74

Amino Acids

8.22

Weight (kDa)

8.89

Isoelectric Point (pI)

39.91

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008163)

Species	Orthologous Gene IDs
pyrus_communis	pycom11g15310 pycom11g15370
rosa_laevigata	RLG00000006965
rosa_multiflora	Rmu_co8253563.1_g000001 Rmu_sc0003371.1_g000003 Rmu_sc0013146.1_g000005 Rmu_sc0013284.1_g000001 Rmu_sc0021708.1_g000005
rosa_roxburghii	Rroxscaffold_1G00027810 Rroxscaffold_1G00042300 Rroxscaffold_1G00042310 Rroxscaffold_3G00237790 Rroxscaffold_3G00237800 Rroxscaffold_4G00285110 Rroxscaffold_5G00345700 Rroxscaffold_5G00345710 Rroxscaffold_5G00352780 Rroxscaffold_7G00192560 Rroxscaffold_7G00204520
rosa_rugosa	Rorug05G0196200
rosa_samantha	Rh6BG433000 Rh6CG482800 Rh7AG241200 Rh7DG247200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	5 cut(s)	47, 56, 168, 186, 195
AluBI	AGCT	1 cut(s)	101
AluI	AGCT	1 cut(s)	101
ApeKI	GCWGC	2 cut(s)	98, 101
Asp700I	GAANNNNTTC	1 cut(s)	15
BbvI	GCAGC	2 cut(s)	88, 110
BfaI	CTAG	1 cut(s)	201
BisI	GCNGC	2 cut(s)	99, 102
BlsI	GCNGC	2 cut(s)	100, 103
BmsI	GCATC	1 cut(s)	169
BseXI	GCAGC	2 cut(s)	88, 110
BsmI	GAATGC	1 cut(s)	148
Bst6I	CTCTTC	1 cut(s)	42
BstAPI	GCANNNNNTGC	1 cut(s)	179
BstC8I	GCNNGC	1 cut(s)	96
BstMWI	GCNNNNNNNGC	2 cut(s)	107, 179
BstV1I	GCAGC	2 cut(s)	88, 110
Cac8I	GCNNGC	1 cut(s)	96
CviJI	RGCY	3 cut(s)	38, 101, 110
CviKI_1	RGCY	3 cut(s)	38, 101, 110
Eam1104I	CTCTTC	1 cut(s)	42
EarI	CTCTTC	1 cut(s)	42
FaiI	YATR	1 cut(s)	15
FalI	AAGNNNNNCTT	2 cut(s)	166, 198
Fnu4HI	GCNGC	2 cut(s)	99, 102
Fsp4HI	GCNGC	2 cut(s)	99, 102
FspBI	CTAG	1 cut(s)	201
GluI	GCNGC	2 cut(s)	99, 102
HpyCH4V	TGCA	1 cut(s)	104
HpyF10VI	GCNNNNNNNGC	2 cut(s)	107, 179
LmnI	GCTCC	1 cut(s)	91
Lsp1109I	GCAGC	2 cut(s)	88, 110
LweI	GCATC	1 cut(s)	169
MaeI	CTAG	1 cut(s)	201
MboII	GAAGA	2 cut(s)	59, 86
MmeI	TCCRAC	1 cut(s)	44
MnlI	CCTC	2 cut(s)	22, 43
MroXI	GAANNNNTTC	1 cut(s)	15
MspA1I	CMGCKG	1 cut(s)	101
Mva1269I	GAATGC	1 cut(s)	148
MwoI	GCNNNNNNNGC	2 cut(s)	107, 179
PctI	GAATGC	1 cut(s)	148
PdmI	GAANNNNTTC	1 cut(s)	15
PkrI	GCNGC	2 cut(s)	100, 103
PvuII	CAGCTG	1 cut(s)	101
SatI	GCNGC	2 cut(s)	99, 102
SetI	ASST	3 cut(s)	54, 103, 156
SfaNI	GCATC	1 cut(s)	169
SgeI	CNNG	4 cut(s)	107, 151, 186, 213
SspMI	CTAG	1 cut(s)	201
TseI	GCWGC	2 cut(s)	98, 101
TspDTI	ATGAA	1 cut(s)	87
XcmI	CCANNNNNNNNNTGG	1 cut(s)	31
XmnI	GAANNNNTTC	1 cut(s)	15
XspI	CTAG	1 cut(s)	201

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.