Rmu_sc0013146.1_g000005

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013146.1
Physical Location & Seq
Reverse (-)
25892 .. 26214
323 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013146.1_g000005.1.cds

Sequence Viewer

Length: 222 bp
atgggattggaatatattcctaccattgaggaaatggctttctttgaagaggttgaaaaagaacaagcagatgaagatagaaaagaaaaggagcaagcagctacattggctgaacagattgttgccactcaacaaagcaagaatgctacaaaggtttccaaagttttaaaggctgtctttgagtttttgactgtttttgtgtttgatgaattgatcaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.4

Weight (kDa)

4.5

Isoelectric Point (pI)

37.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 47, 56
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
ApeKI GCWGC 1 cut(s) 98
Asp700I GAANNNNTTC 1 cut(s) 15
BbvI GCAGC 1 cut(s) 110
BclI TGATCA 1 cut(s) 213
BisI GCNGC 1 cut(s) 99
BlsI GCNGC 1 cut(s) 100
BseXI GCAGC 1 cut(s) 110
BsmI GAATGC 1 cut(s) 148
Bsp143I GATC 1 cut(s) 213
BssMI GATC 1 cut(s) 213
Bst4CI ACNGT 1 cut(s) 193
Bst6I CTCTTC 1 cut(s) 42
BstC8I GCNNGC 1 cut(s) 96
BstKTI GATC 1 cut(s) 216
BstMBI GATC 1 cut(s) 213
BstMWI GCNNNNNNNGC 1 cut(s) 107
BstV1I GCAGC 1 cut(s) 110
Cac8I GCNNGC 1 cut(s) 96
CviJI RGCY 4 cut(s) 38, 101, 110, 173
CviKI_1 RGCY 4 cut(s) 38, 101, 110, 173
DpnI GATC 1 cut(s) 215
DpnII GATC 1 cut(s) 213
DraI TTTAAA 1 cut(s) 168
Eam1104I CTCTTC 1 cut(s) 42
EarI CTCTTC 1 cut(s) 42
FaiI YATR 1 cut(s) 15
FalI AAGNNNNNCTT 2 cut(s) 161, 193
FbaI TGATCA 1 cut(s) 213
Fnu4HI GCNGC 1 cut(s) 99
Fsp4HI GCNGC 1 cut(s) 99
GluI GCNGC 1 cut(s) 99
HpyCH4III ACNGT 1 cut(s) 193
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
Ksp22I TGATCA 1 cut(s) 213
Kzo9I GATC 1 cut(s) 213
LmnI GCTCC 1 cut(s) 91
Lsp1109I GCAGC 1 cut(s) 110
MalI GATC 1 cut(s) 215
MboI GATC 1 cut(s) 213
MboII GAAGA 2 cut(s) 59, 86
MluCI AATT 1 cut(s) 209
MnlI CCTC 2 cut(s) 22, 43
MroXI GAANNNNTTC 1 cut(s) 15
MseI TTAA 1 cut(s) 167
Mva1269I GAATGC 1 cut(s) 148
MwoI GCNNNNNNNGC 1 cut(s) 107
NdeII GATC 1 cut(s) 213
PctI GAATGC 1 cut(s) 148
PdmI GAANNNNTTC 1 cut(s) 15
PkrI GCNGC 1 cut(s) 100
SaqAI TTAA 1 cut(s) 167
SatI GCNGC 1 cut(s) 99
Sau3AI GATC 1 cut(s) 213
SetI ASST 3 cut(s) 54, 103, 156
SgeI CNNG 3 cut(s) 77, 107, 151
Sse9I AATT 1 cut(s) 209
TaaI ACNGT 1 cut(s) 193
TasI AATT 1 cut(s) 209
Tru1I TTAA 1 cut(s) 167
Tru9I TTAA 1 cut(s) 167
TseI GCWGC 1 cut(s) 98
TspDTI ATGAA 2 cut(s) 87, 222
XcmI CCANNNNNNNNNTGG 1 cut(s) 31
XmnI GAANNNNTTC 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.