Rmu_sc0004732.1_g000003

disease resistance RPP13-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004732.1
Physical Location & Seq
Reverse (-)
9609 .. 10667
1059 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004732.1_g000003.1.cds

Sequence Viewer

Length: 1059 bp
atggaatggtccaaattgaagaatgtgaaggttctttatcttggaaggtggcacagcagggcaaaacatcacattgaactagttgacagcaagttcttggaagcgttggtgtttatgacacgtttgaggtttctcagccttcgaggaatatcggggatcatggagcttcctgattcattatgcaagcttgtttgtttgaagatcttggatcttggagcatgtcacaatctagaggtgattccgaaacaaataagcttgcttaagaagctcacacacttggatatgtccgagtgttacttactggatcgtatgcctaaggggatcgcattgctctcagaactcgaagttcttaaggggttcataattggtgatcacaagaagcacacttcatgtactctgcatgatttgtcaggattgcaaaagttgaaaaaattgacaattaacacaagcagggaggattttcccaacgaagaagagctaaccgttttacaaggatttggttcgcttcaaaagctaacaatagcatggggaggagtagaatttcttgccaaccgccaaaataagcataggaagcaggacaatgttggagcacaaccaaaagcagcaagcacaacggatgccagtggaggtaacagaaatgaagatgatgctaatggcattcaaaatcatgtgccaaaaaccccggcaaggtcattaaccttcaagcgaagggctatattggctccgaggattcgggaacattttgaagcacttgagaaactggacttgcaatgctaccctcatatgaaagcaccgacttggttgactcccggaatgctcaagaagctggaaaaactctacattagagggggacagctccaaagtctaggtcaagttcaggagagtgacaagtggacagttgagatattgcgtttgaagttcttgagtgaactaaagatggattggaatgacctccagtcagcatttctaaaattgaattatgtggagaaatttagatgccctaagaccactttcttcccatgcgatgagactggagtctggctgaagcccggaaactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

352

Amino Acids

40.24

Weight (kDa)

9.3

Isoelectric Point (pI)

46.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 553
AclWI GGATC 4 cut(s) 164, 216, 312, 329
AcsI RAATTY 2 cut(s) 539, 989
AfaI GTAC 1 cut(s) 394
AfiI CCNNNNNNNGG 1 cut(s) 687
AflII CTTAAG 2 cut(s) 260, 350
AflIII ACRYGT 1 cut(s) 119
AhdI GACNNNNNGTC 1 cut(s) 955
AhlI ACTAGT 1 cut(s) 79
AluBI AGCT 8 cut(s) 166, 187, 255, 268, 478, 514, 826, 856
AluI AGCT 8 cut(s) 166, 187, 255, 268, 478, 514, 826, 856
Alw21I GWGCWC 1 cut(s) 592
Alw26I GTCTC 1 cut(s) 1022
AlwI GGATC 4 cut(s) 164, 216, 312, 329
ApeKI GCWGC 1 cut(s) 602
ApoI RAATTY 2 cut(s) 539, 989
ArsI GACNNNNNNTTYG 2 cut(s) 853, 885
AspS9I GGNCC 1 cut(s) 9
AsuC2I CCSGG 3 cut(s) 683, 810, 1050
AsuHPI GGTGA 2 cut(s) 247, 380
AvaII GGWCC 1 cut(s) 9
AxyI CCTNAGG 1 cut(s) 315
Bbv12I GWGCWC 1 cut(s) 592
BbvI GCAGC 1 cut(s) 614
BccI CCATC 1 cut(s) 931
BclI TGATCA 1 cut(s) 370
BcnI CCSGG 3 cut(s) 683, 810, 1050
BcoDI GTCTC 1 cut(s) 1022
BcuI ACTAGT 1 cut(s) 79
BfaI CTAG 3 cut(s) 80, 230, 866
BfrI CTTAAG 2 cut(s) 260, 350
BglII AGATCT 1 cut(s) 201
BisI GCNGC 1 cut(s) 603
BlsI GCNGC 1 cut(s) 604
Bme1390I CCNGG 3 cut(s) 683, 810, 1050
Bme18I GGWCC 1 cut(s) 9
BmeRI GACNNNNNGTC 1 cut(s) 955
BmgT120I GGNCC 1 cut(s) 9
BmiI GGNNCC 1 cut(s) 723
BmrFI CCNGG 3 cut(s) 683, 810, 1050
BmsI GCATC 3 cut(s) 607, 637, 986
BoxI GACNNNNGTC 1 cut(s) 1034
BpmI CTGGAG 2 cut(s) 938, 1053
BpuEI CTTGAG 3 cut(s) 773, 803, 943
BpuMI CCSGG 3 cut(s) 683, 810, 1050
BsaJI CCNNGG 2 cut(s) 681, 725
Bsc4I CCNNNNNNNGG 1 cut(s) 687
Bse1I ACTGG 5 cut(s) 306, 621, 765, 955, 1036
Bse21I CCTNAGG 1 cut(s) 315
Bse3DI GCAATG 2 cut(s) 326, 776
BseDI CCNNGG 2 cut(s) 681, 725
BseGI GGATG 1 cut(s) 622
BseLI CCNNNNNNNGG 1 cut(s) 687
BseMI GCAATG 2 cut(s) 326, 776
BseMII CTCAG 2 cut(s) 148, 348
BseNI ACTGG 5 cut(s) 306, 621, 765, 955, 1036
BseRI GAGGAG 1 cut(s) 546
BseXI GCAGC 1 cut(s) 614
BsiHKAI GWGCWC 1 cut(s) 592
BsiSI CCGG 3 cut(s) 683, 810, 1050
BslFI GGGAC 1 cut(s) 864
BslI CCNNNNNNNGG 1 cut(s) 687
BsmAI GTCTC 1 cut(s) 1022
BsmFI GGGAC 1 cut(s) 864
BsmI GAATGC 2 cut(s) 657, 819
Bsp1286I GDGCHC 1 cut(s) 592
Bsp143I GATC 6 cut(s) 156, 201, 208, 304, 321, 370
BspACI CCGC 1 cut(s) 553
BspCNI CTCAG 2 cut(s) 147, 347
BspLI GGNNCC 1 cut(s) 723
BspPI GGATC 4 cut(s) 164, 216, 312, 329
BspQI GCTCTTC 1 cut(s) 468
BspTI CTTAAG 2 cut(s) 260, 350
BsrDI GCAATG 2 cut(s) 326, 776
BsrI ACTGG 5 cut(s) 306, 621, 765, 955, 1036
BssECI CCNNGG 2 cut(s) 681, 725
BssMI GATC 6 cut(s) 156, 201, 208, 304, 321, 370
Bst4CI ACNGT 2 cut(s) 484, 898
Bst6I CTCTTC 1 cut(s) 468
BstAFI CTTAAG 2 cut(s) 260, 350
BstC8I GCNNGC 3 cut(s) 185, 257, 607
BstDEI CTNAG 4 cut(s) 134, 315, 334, 1002
BstF5I GGATG 1 cut(s) 622
BstKTI GATC 6 cut(s) 159, 204, 211, 307, 324, 373
BstMAI GTCTC 1 cut(s) 1022
BstMBI GATC 6 cut(s) 156, 201, 208, 304, 321, 370
BstMWI GCNNNNNNNGC 5 cut(s) 265, 511, 571, 719, 823
BstNSI RCATGY 1 cut(s) 222
BstPAI GACNNNNGTC 1 cut(s) 1034
BstSCI CCNGG 3 cut(s) 681, 808, 1048
BstV1I GCAGC 1 cut(s) 614
BstX2I RGATCY 2 cut(s) 201, 208
BstYI RGATCY 2 cut(s) 201, 208
Bsu36I CCTNAGG 1 cut(s) 315
BtgZI GCGATG 1 cut(s) 1038
BtsCI GGATG 1 cut(s) 622
BtsIMutI CAGTG 1 cut(s) 628
Cac8I GCNNGC 3 cut(s) 185, 257, 607
Cfr13I GGNCC 1 cut(s) 9
Csp6I GTAC 1 cut(s) 393
CviAII CATG 7 cut(s) 160, 219, 390, 401, 525, 668, 1020
CviQI GTAC 1 cut(s) 393
DdeI CTNAG 4 cut(s) 134, 315, 334, 1002
DpnI GATC 6 cut(s) 158, 203, 210, 306, 323, 372
DpnII GATC 6 cut(s) 156, 201, 208, 304, 321, 370
DriI GACNNNNNGTC 1 cut(s) 955
Eam1104I CTCTTC 1 cut(s) 468
Eam1105I GACNNNNNGTC 1 cut(s) 955
EarI CTCTTC 1 cut(s) 468
Eco47I GGWCC 1 cut(s) 9
Eco81I CCTNAGG 1 cut(s) 315
FaeI CATG 7 cut(s) 163, 222, 393, 404, 528, 671, 1023
FaqI GGGAC 1 cut(s) 864
FatI CATG 7 cut(s) 159, 218, 389, 400, 524, 667, 1019
FauNDI CATATG 1 cut(s) 783
FbaI TGATCA 1 cut(s) 370
Fnu4HI GCNGC 1 cut(s) 603
FokI GGATG 1 cut(s) 629
Fsp4HI GCNGC 1 cut(s) 603
FspBI CTAG 3 cut(s) 80, 230, 866
GluI GCNGC 1 cut(s) 603
GsuI CTGGAG 2 cut(s) 938, 1053
HapII CCGG 3 cut(s) 683, 810, 1050
Hin1II CATG 7 cut(s) 163, 222, 393, 404, 528, 671, 1023
HincII GTYRAC 2 cut(s) 85, 804
HindII GTYRAC 2 cut(s) 85, 804
HindIII AAGCTT 2 cut(s) 185, 253
HinfI GANTC 5 cut(s) 173, 238, 730, 805, 1035
HpaII CCGG 3 cut(s) 683, 810, 1050
HphI GGTGA 2 cut(s) 247, 380
Hpy166II GTNNAC 4 cut(s) 85, 804, 894, 929
Hpy188I TCNGA 4 cut(s) 243, 289, 337, 726
Hpy188III TCNNGA 7 cut(s) 170, 230, 411, 734, 820, 878, 922
Hpy8I GTNNAC 4 cut(s) 85, 804, 894, 929
HpyAV CCTTC 5 cut(s) 22, 39, 149, 702, 709
HpyCH4III ACNGT 2 cut(s) 484, 898
HpyCH4IV ACGT 1 cut(s) 121
HpyCH4V TGCA 4 cut(s) 183, 400, 418, 769
HpyF10VI GCNNNNNNNGC 5 cut(s) 265, 511, 571, 719, 823
HpyF3I CTNAG 4 cut(s) 134, 315, 334, 1002
HpySE526I ACGT 1 cut(s) 121
Hsp92II CATG 7 cut(s) 163, 222, 393, 404, 528, 671, 1023
Ksp22I TGATCA 1 cut(s) 370
Kzo9I GATC 6 cut(s) 156, 201, 208, 304, 321, 370
LguI GCTCTTC 1 cut(s) 468
LmnI GCTCC 5 cut(s) 163, 215, 587, 727, 861
Lsp1109I GCAGC 1 cut(s) 614
LweI GCATC 3 cut(s) 607, 637, 986
MaeI CTAG 3 cut(s) 80, 230, 866
MaeII ACGT 1 cut(s) 121
MaeIII GTNAC 4 cut(s) 221, 293, 629, 884
MalI GATC 6 cut(s) 158, 203, 210, 306, 323, 372
MboI GATC 6 cut(s) 156, 201, 208, 304, 321, 370
MboII GAAGA 6 cut(s) 31, 211, 482, 485, 653, 1006
MflI RGATCY 2 cut(s) 201, 208
MhlI GDGCHC 1 cut(s) 592
MluCI AATT 8 cut(s) 14, 363, 431, 438, 539, 971, 976, 989
MlyI GAGTC 2 cut(s) 799, 1044
MmeI TCCRAC 1 cut(s) 565
MseI TTAA 4 cut(s) 261, 351, 441, 695
MspCI CTTAAG 2 cut(s) 260, 350
MspI CCGG 3 cut(s) 683, 810, 1050
MspR9I CCNGG 3 cut(s) 683, 810, 1050
Mva1269I GAATGC 2 cut(s) 657, 819
MwoI GCNNNNNNNGC 5 cut(s) 265, 511, 571, 719, 823
NciI CCSGG 3 cut(s) 683, 810, 1050
NdeI CATATG 1 cut(s) 783
NdeII GATC 6 cut(s) 156, 201, 208, 304, 321, 370
NlaIII CATG 7 cut(s) 163, 222, 393, 404, 528, 671, 1023
NlaIV GGNNCC 1 cut(s) 723
NmuCI GTSAC 2 cut(s) 221, 884
NspI RCATGY 1 cut(s) 222
PciSI GCTCTTC 1 cut(s) 468
PctI GAATGC 2 cut(s) 657, 819
PfeI GAWTC 3 cut(s) 173, 238, 730
PfoI TCCNGGA 1 cut(s) 808
PkrI GCNGC 1 cut(s) 604
PleI GAGTC 2 cut(s) 799, 1043
PpsI GAGTC 2 cut(s) 799, 1043
PshAI GACNNNNGTC 1 cut(s) 1034
PspN4I GGNNCC 1 cut(s) 723
PspPI GGNCC 1 cut(s) 9
PsuI RGATCY 2 cut(s) 201, 208
RsaI GTAC 1 cut(s) 394
RsaNI GTAC 1 cut(s) 393
SapI GCTCTTC 1 cut(s) 468
SaqAI TTAA 4 cut(s) 261, 351, 441, 695
SatI GCNGC 1 cut(s) 603
Sau3AI GATC 6 cut(s) 156, 201, 208, 304, 321, 370
Sau96I GGNCC 1 cut(s) 9
SchI GAGTC 2 cut(s) 799, 1044
ScrFI CCNGG 3 cut(s) 683, 810, 1050
SduI GDGCHC 1 cut(s) 592
SfaNI GCATC 3 cut(s) 607, 637, 986
SinI GGWCC 1 cut(s) 9
SmlI CTYRAG 5 cut(s) 260, 350, 752, 818, 922
SmoI CTYRAG 5 cut(s) 260, 350, 752, 818, 922
SpeI ACTAGT 1 cut(s) 79
Sse9I AATT 8 cut(s) 14, 363, 431, 438, 539, 971, 976, 989
SsiI CCGC 1 cut(s) 553
SspMI CTAG 3 cut(s) 80, 230, 866
StyD4I CCNGG 3 cut(s) 681, 808, 1048
TaaI ACNGT 2 cut(s) 484, 898
TaiI ACGT 1 cut(s) 124
TaqI TCGA 2 cut(s) 142, 342
TasI AATT 8 cut(s) 14, 363, 431, 438, 539, 971, 976, 989
TatI WGTACW 1 cut(s) 392
TfiI GAWTC 3 cut(s) 173, 238, 730
Tru1I TTAA 4 cut(s) 261, 351, 441, 695
Tru9I TTAA 4 cut(s) 261, 351, 441, 695
TscAI CASTG 1 cut(s) 628
TseFI GTSAC 2 cut(s) 221, 884
TseI GCWGC 1 cut(s) 602
Tsp45I GTSAC 2 cut(s) 221, 884
TspDTI ATGAA 5 cut(s) 165, 349, 378, 654, 800
TspGWI ACGGA 1 cut(s) 629
TspRI CASTG 1 cut(s) 628
Vha464I CTTAAG 2 cut(s) 260, 350
VpaK11BI GGWCC 1 cut(s) 9
XapI RAATTY 2 cut(s) 539, 989
XbaI TCTAGA 1 cut(s) 229
XceI RCATGY 1 cut(s) 222
XspI CTAG 3 cut(s) 80, 230, 866
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.