Rorug03G0176100

disease resistance RPP13-like protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
14931072 .. 14932191
1120 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0176100.1

Sequence Viewer

Length: 324 bp
ATGTCCTCACAAAACACCTCTTCAACCATAAAGTCTAGATTAGCCGATACAGCAACTATCCTGCAGAAGAGTTCTTCAAGACCCAACCCGAACCCAAAGGGGTTGAATGAGTCTGACAGGGCCAATCGGGAATTCGAGGACGAAATCGAGAAGGGGTTGCTGATTCAAGACAGGGACTTTGTCTTGGGATGGAAGTCTGGAAGGGTACAAGAATGTGAGTTGAGGGCTAAGGACAATGAGCATCGTGGAGGTGCAGTTCGCGACGGCGAAGATGTCAAGGTTTCGGTCTCATTGGCGACAGCCATTCCATTCCCCAGGATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

11.87

Weight (kDa)

6.59

Isoelectric Point (pI)

46.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 261
AcsI RAATTY 1 cut(s) 131
AfaI GTAC 1 cut(s) 207
AgsI TTSAA 4 cut(s) 24, 78, 106, 167
AjnI CCWGG 1 cut(s) 314
AjuI GAANNNNNNNTTGG 2 cut(s) 116, 148
AloI GAACNNNNNNTCC 2 cut(s) 240, 272
Alw26I GTCTC 1 cut(s) 292
AoxI GGCC 1 cut(s) 120
ApoI RAATTY 1 cut(s) 131
ArsI GACNNNNNNTTYG 2 cut(s) 161, 193
AspS9I GGNCC 1 cut(s) 120
BccI CCATC 1 cut(s) 183
BceAI ACGGC 1 cut(s) 280
BciT130I CCWGG 1 cut(s) 316
BcoDI GTCTC 1 cut(s) 292
BfaI CTAG 1 cut(s) 36
BfmI CTRYAG 1 cut(s) 62
Bme1390I CCNGG 1 cut(s) 316
BmgT120I GGNCC 1 cut(s) 120
BmrFI CCNGG 1 cut(s) 316
BmsI GCATC 1 cut(s) 250
Bpu10I CCTNAGC 1 cut(s) 228
BsaI GGTCTC 1 cut(s) 292
BsaJI CCNNGG 1 cut(s) 314
BsaXI ACNNNNNCTCC 2 cut(s) 240, 270
BseBI CCWGG 1 cut(s) 316
BseDI CCNNGG 1 cut(s) 314
BseGI GGATG 1 cut(s) 194
BsgI GTGCAG 1 cut(s) 273
Bsh1236I CGCG 1 cut(s) 261
BshFI GGCC 1 cut(s) 122
BslFI GGGAC 1 cut(s) 188
BsmAI GTCTC 1 cut(s) 292
BsmFI GGGAC 1 cut(s) 188
BsnI GGCC 1 cut(s) 122
Bso31I GGTCTC 1 cut(s) 292
Bsp68I TCGCGA 1 cut(s) 261
BspANI GGCC 1 cut(s) 122
BspFNI CGCG 1 cut(s) 261
BspMAI CTGCAG 1 cut(s) 66
BspTNI GGTCTC 1 cut(s) 292
BssECI CCNNGG 1 cut(s) 314
Bst2UI CCWGG 1 cut(s) 316
Bst6I CTCTTC 2 cut(s) 25, 62
BstDEI CTNAG 1 cut(s) 228
BstF5I GGATG 1 cut(s) 194
BstFNI CGCG 1 cut(s) 261
BstMAI GTCTC 1 cut(s) 292
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 316
BstSCI CCNGG 1 cut(s) 314
BstSFI CTRYAG 1 cut(s) 62
BstUI CGCG 1 cut(s) 261
BsuRI GGCC 1 cut(s) 122
BtsCI GGATG 1 cut(s) 194
BtuMI TCGCGA 1 cut(s) 261
Cfr13I GGNCC 1 cut(s) 120
Csp6I GTAC 1 cut(s) 206
CviJI RGCY 4 cut(s) 44, 122, 227, 302
CviKI_1 RGCY 4 cut(s) 44, 122, 227, 302
CviQI GTAC 1 cut(s) 206
DdeI CTNAG 1 cut(s) 228
Eam1104I CTCTTC 2 cut(s) 25, 62
EarI CTCTTC 2 cut(s) 25, 62
Eco31I GGTCTC 1 cut(s) 292
EcoRI GAATTC 1 cut(s) 131
EcoRII CCWGG 1 cut(s) 314
FaiI YATR 2 cut(s) 29, 322
FaqI GGGAC 1 cut(s) 188
FokI GGATG 1 cut(s) 201
FspBI CTAG 1 cut(s) 36
HaeIII GGCC 1 cut(s) 122
HinfI GANTC 2 cut(s) 110, 163
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 7 cut(s) 36, 78, 128, 148, 167, 198, 260
Hpy99I CGWCG 1 cut(s) 266
HpyAV CCTTC 2 cut(s) 145, 195
HpyCH4V TGCA 2 cut(s) 64, 254
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
HpyF3I CTNAG 1 cut(s) 228
LpnPI CCDG 5 cut(s) 74, 103, 157, 183, 301
LweI GCATC 1 cut(s) 250
MaeI CTAG 1 cut(s) 36
MboII GAAGA 4 cut(s) 12, 66, 79, 281
MluCI AATT 1 cut(s) 131
MlyI GAGTC 1 cut(s) 119
MnlI CCTC 5 cut(s) 16, 28, 130, 216, 242
MspR9I CCNGG 1 cut(s) 316
MvaI CCWGG 1 cut(s) 316
MvnI CGCG 1 cut(s) 261
MwoI GCNNNNNNNGC 1 cut(s) 50
NruI TCGCGA 1 cut(s) 261
PfeI GAWTC 1 cut(s) 163
PflFI GACNNNGTC 1 cut(s) 179
PleI GAGTC 1 cut(s) 118
PpsI GAGTC 1 cut(s) 118
Psp6I CCWGG 1 cut(s) 314
PspGI CCWGG 1 cut(s) 314
PspPI GGNCC 1 cut(s) 120
PstI CTGCAG 1 cut(s) 66
PsyI GACNNNGTC 1 cut(s) 179
RruI TCGCGA 1 cut(s) 261
RsaI GTAC 1 cut(s) 207
RsaNI GTAC 1 cut(s) 206
Sau96I GGNCC 1 cut(s) 120
SchI GAGTC 1 cut(s) 119
ScrFI CCNGG 1 cut(s) 316
SetI ASST 3 cut(s) 20, 253, 282
SfaNI GCATC 1 cut(s) 250
SfcI CTRYAG 1 cut(s) 62
Sse9I AATT 1 cut(s) 131
SspMI CTAG 1 cut(s) 36
StyD4I CCNGG 1 cut(s) 314
TaqI TCGA 2 cut(s) 135, 147
TaqII GACCGA 1 cut(s) 274
TasI AATT 1 cut(s) 131
TfiI GAWTC 1 cut(s) 163
Tth111I GACNNNGTC 1 cut(s) 179
XapI RAATTY 1 cut(s) 131
XbaI TCTAGA 1 cut(s) 35
XspI CTAG 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.