Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005292.1

Orthogroup ID

OG0002631

Physical Location & Seq

Genomic Coordinates Forward (+)

683 .. 3367

Gene Structure 2685 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005292.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 561 bp

atggatgagtttctgatgtccaatagtttacctttgcgacctggacttgaagaatttattgatgatgcatacaatgaaggaatacctgtggtcatattgacatcctatagtaaaagtggggatgcaatttccagatccatcattgaaaagcttggccatgaaagaattttgaagctaaagattgttggggataaggaggtggaacagagtttatatggtcaatttgtatccagtaaagtcttttcttcaggtgtggatgaggaactagctaaggaagcaatgaaagcagtttctgctgagaaacaaaggattgctgaggaggttgcatcaatgctaaagttgaatgtagaacttgatactacctcatctaaaagcttacagaagatcatagctaccttgagggcaggggcagaaaatgctggactacctgtctccaattgtgttctaattgcaggaagccagtcaggtgtagtaggagctcagcgagtgggcatgccatgtgttgttttaagaagcaggtattttttcttgccactcaagtcatacgatcaccacctgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

186

Amino Acids

20.29

Weight (kDa)

5.69

Isoelectric Point (pI)

42.05

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002631)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G45170 AT5G45170
fragaria_vesca	FvH4_3g11870 FvH4_3g11870 FvH4_3g11870 FvH4_3g11870 FvH4_3g11870
malus_domestica	MD10G1237500.v1.1 MD10G1237600.v1.1 MD10G1238000.v1.1
prunus_persica	Prupe.4G106200_v2.0.a1 Prupe.4G106200_v2.0.a1 Prupe.4G106200_v2.0.a1
pyrus_communis	pycom10g19890 pycom10g19900 pycom10g19910
rosa_chinensis	RchiOBHm_Chr5g0019301 RchiOBHm_Chr5g0019331 RchiOBHm_Chr5g0019341
rosa_laevigata	RLG00000032436 RLG00000032439
rosa_multiflora	Rmu_sc0002141.1_g000019 Rmu_sc0002759.1_g000029 Rmu_sc0005292.1_g000001 Rmu_sc0005292.1_g000024
rosa_roxburghii	Rroxscaffold_1G00058680 Rroxscaffold_1G00058690 Rroxscaffold_1G00074220 Rroxscaffold_1G00074230
rosa_rugosa	Rorug01G0008700 Rorug05G0049500 Rorug05G0050700
rosa_samantha	Rh5AG140600 Rh5BG139600 Rh5CG150900 Rh5CG151300 Rh5DG140100 Rh5DG140500
rosa_wichuraiana	Rw5G012500 Rw5G012520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	507
AclWI	GGATC	1 cut(s)	129
AcoI	YGGCCR	1 cut(s)	154
AcsI	RAATTY	2 cut(s)	53, 165
AcuI	CTGAAG	1 cut(s)	231
AgsI	TTSAA	4 cut(s)	50, 146, 172, 343
AhdI	GACNNNNNGTC	1 cut(s)	428
AjnI	CCWGG	1 cut(s)	40
AluBI	AGCT	6 cut(s)	151, 175, 269, 375, 392, 479
AluI	AGCT	6 cut(s)	151, 175, 269, 375, 392, 479
Alw21I	GWGCWC	1 cut(s)	481
Alw26I	GTCTC	1 cut(s)	436
AlwI	GGATC	1 cut(s)	129
AlwNI	CAGNNNCTG	1 cut(s)	293
AoxI	GGCC	1 cut(s)	154
ApoI	RAATTY	2 cut(s)	53, 165
AsuHPI	GGTGA	1 cut(s)	542
BalI	TGGCCA	1 cut(s)	156
BanII	GRGCYC	1 cut(s)	481
Bbv12I	GWGCWC	1 cut(s)	481
BbvCI	CCTCAGC	1 cut(s)	315
BccI	CCATC	1 cut(s)	146
BciT130I	CCWGG	1 cut(s)	42
BciVI	GTATCC	1 cut(s)	238
BcoDI	GTCTC	1 cut(s)	436
BfaI	CTAG	1 cut(s)	266
BfmI	CTRYAG	1 cut(s)	106
BfuAI	ACCTGC	1 cut(s)	507
BfuI	GTATCC	1 cut(s)	238
BlpI	GCTNAGC	1 cut(s)	480
Bme1390I	CCNGG	1 cut(s)	42
BmeRI	GACNNNNNGTC	1 cut(s)	428
BmrFI	CCNGG	1 cut(s)	42
BmsI	GCATC	3 cut(s)	55, 112, 335
Bpu10I	CCTNAGC	2 cut(s)	270, 315
Bpu1102I	GCTNAGC	1 cut(s)	480
BpuEI	CTTGAG	2 cut(s)	418, 521
Bse1I	ACTGG	2 cut(s)	231, 460
Bse3DI	GCAATG	1 cut(s)	285
BseBI	CCWGG	1 cut(s)	42
BseGI	GGATG	4 cut(s)	10, 101, 127, 262
BseMI	GCAATG	1 cut(s)	285
BseMII	CTCAG	3 cut(s)	288, 306, 494
BseNI	ACTGG	2 cut(s)	231, 460
BseRI	GAGGAG	1 cut(s)	332
BshFI	GGCC	1 cut(s)	156
BsiHKAI	GWGCWC	1 cut(s)	481
BsmAI	GTCTC	1 cut(s)	436
BsnI	GGCC	1 cut(s)	156
Bsp1286I	GDGCHC	1 cut(s)	481
Bsp143I	GATC	3 cut(s)	134, 384, 547
Bsp1720I	GCTNAGC	1 cut(s)	480
BspANI	GGCC	1 cut(s)	156
BspCNI	CTCAG	3 cut(s)	289, 307, 493
BspMI	ACCTGC	1 cut(s)	507
BspPI	GGATC	1 cut(s)	129
BsrDI	GCAATG	1 cut(s)	285
BsrI	ACTGG	2 cut(s)	231, 460
BssMI	GATC	3 cut(s)	134, 384, 547
Bst2UI	CCWGG	1 cut(s)	42
BstAPI	GCANNNNNTGC	2 cut(s)	293, 416
BstC8I	GCNNGC	1 cut(s)	494
BstDEI	CTNAG	4 cut(s)	270, 297, 315, 480
BstF5I	GGATG	4 cut(s)	10, 101, 127, 262
BstKTI	GATC	3 cut(s)	137, 387, 550
BstMAI	GTCTC	1 cut(s)	436
BstMBI	GATC	3 cut(s)	134, 384, 547
BstMWI	GCNNNNNNNGC	4 cut(s)	275, 284, 293, 416
BstNI	CCWGG	1 cut(s)	42
BstNSI	RCATGY	1 cut(s)	496
BstSCI	CCNGG	1 cut(s)	40
BstSFI	CTRYAG	1 cut(s)	106
BstX2I	RGATCY	1 cut(s)	134
BstYI	RGATCY	1 cut(s)	134
BsuI	GTATCC	1 cut(s)	238
BsuRI	GGCC	1 cut(s)	156
BtsCI	GGATG	4 cut(s)	10, 101, 127, 262
BveI	ACCTGC	1 cut(s)	507
Cac8I	GCNNGC	1 cut(s)	494
CaiI	CAGNNNCTG	1 cut(s)	293
CviAII	CATG	3 cut(s)	158, 493, 498
CviJI	RGCY	8 cut(s)	151, 156, 175, 269, 375, 392, 459, 479
CviKI_1	RGCY	8 cut(s)	151, 156, 175, 269, 375, 392, 459, 479
DdeI	CTNAG	4 cut(s)	270, 297, 315, 480
DpnI	GATC	3 cut(s)	136, 386, 549
DpnII	GATC	3 cut(s)	134, 384, 547
DriI	GACNNNNNGTC	1 cut(s)	428
EaeI	YGGCCR	1 cut(s)	154
Eam1105I	GACNNNNNGTC	1 cut(s)	428
Ecl136II	GAGCTC	1 cut(s)	479
Eco24I	GRGCYC	1 cut(s)	481
Eco53kI	GAGCTC	1 cut(s)	479
Eco57I	CTGAAG	1 cut(s)	231
EcoICRI	GAGCTC	1 cut(s)	479
EcoRII	CCWGG	1 cut(s)	40
EcoT22I	ATGCAT	1 cut(s)	70
EcoT38I	GRGCYC	1 cut(s)	481
FaeI	CATG	3 cut(s)	161, 496, 501
FatI	CATG	3 cut(s)	157, 492, 497
FokI	GGATG	4 cut(s)	17, 88, 134, 269
FriOI	GRGCYC	1 cut(s)	481
FspBI	CTAG	1 cut(s)	266
HaeIII	GGCC	1 cut(s)	156
Hin1II	CATG	3 cut(s)	161, 496, 501
HindIII	AAGCTT	2 cut(s)	149, 373
HphI	GGTGA	1 cut(s)	542
Hpy166II	GTNNAC	1 cut(s)	29
Hpy188I	TCNGA	1 cut(s)	15
Hpy188III	TCNNGA	1 cut(s)	132
Hpy8I	GTNNAC	1 cut(s)	29
HpyAV	CCTTC	1 cut(s)	71
HpyCH4V	TGCA	4 cut(s)	68, 125, 326, 452
HpyF10VI	GCNNNNNNNGC	4 cut(s)	275, 284, 293, 416
HpyF3I	CTNAG	4 cut(s)	270, 297, 315, 480
Hsp92II	CATG	3 cut(s)	161, 496, 501
Kzo9I	GATC	3 cut(s)	134, 384, 547
LmnI	GCTCC	1 cut(s)	476
LweI	GCATC	3 cut(s)	55, 112, 335
MaeI	CTAG	1 cut(s)	266
MalI	GATC	3 cut(s)	136, 386, 549
MboI	GATC	3 cut(s)	134, 384, 547
MboII	GAAGA	3 cut(s)	62, 237, 394
MfeI	CAATTG	1 cut(s)	436
MflI	RGATCY	1 cut(s)	134
MhlI	GDGCHC	1 cut(s)	481
MlsI	TGGCCA	1 cut(s)	156
MluCI	AATT	6 cut(s)	53, 126, 165, 221, 436, 447
MluNI	TGGCCA	1 cut(s)	156
MnlI	CCTC	6 cut(s)	190, 253, 310, 313, 373, 393
Mox20I	TGGCCA	1 cut(s)	156
Mph1103I	ATGCAT	1 cut(s)	70
MscI	TGGCCA	1 cut(s)	156
MseI	TTAA	1 cut(s)	509
Msp20I	TGGCCA	1 cut(s)	156
MspR9I	CCNGG	1 cut(s)	42
MunI	CAATTG	1 cut(s)	436
MvaI	CCWGG	1 cut(s)	42
MwoI	GCNNNNNNNGC	4 cut(s)	275, 284, 293, 416
NdeII	GATC	3 cut(s)	134, 384, 547
NlaIII	CATG	3 cut(s)	161, 496, 501
NsiI	ATGCAT	1 cut(s)	70
NspI	RCATGY	1 cut(s)	496
PaeI	GCATGC	1 cut(s)	496
Psp124BI	GAGCTC	1 cut(s)	481
Psp6I	CCWGG	1 cut(s)	40
PspGI	CCWGG	1 cut(s)	40
PstNI	CAGNNNCTG	1 cut(s)	293
PsuI	RGATCY	1 cut(s)	134
SacI	GAGCTC	1 cut(s)	481
SaqAI	TTAA	1 cut(s)	509
Sau3AI	GATC	3 cut(s)	134, 384, 547
ScrFI	CCNGG	1 cut(s)	42
SduI	GDGCHC	1 cut(s)	481
SfaNI	GCATC	3 cut(s)	55, 112, 335
SfcI	CTRYAG	1 cut(s)	106
SmlI	CTYRAG	2 cut(s)	397, 536
SmoI	CTYRAG	2 cut(s)	397, 536
SphI	GCATGC	1 cut(s)	496
Sse9I	AATT	6 cut(s)	53, 126, 165, 221, 436, 447
SspMI	CTAG	1 cut(s)	266
SstI	GAGCTC	1 cut(s)	481
StyD4I	CCNGG	1 cut(s)	40
TasI	AATT	6 cut(s)	53, 126, 165, 221, 436, 447
Tru1I	TTAA	1 cut(s)	509
Tru9I	TTAA	1 cut(s)	509
TspDTI	ATGAA	3 cut(s)	90, 174, 296
XapI	RAATTY	2 cut(s)	53, 165
XceI	RCATGY	1 cut(s)	496
XspI	CTAG	1 cut(s)	266
Zsp2I	ATGCAT	1 cut(s)	70

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.