Rmu_sc0005693.1_g000021

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005693.1
OG0008182
Physical Location & Seq
Forward (+)
72304 .. 73446
1143 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005693.1_g000021.1.cds

Sequence Viewer

Length: 1143 bp
atgttggtggtgggagagtatgacggcctgagtccagtagagatggtgcctttgaacatgatggaaacctgggttgcggttaagggactaccttttgctctgagaaataagacggtgttgtccatggtgggatcgaccctcggaagggtgctccggttggatcctaccactctaaaaagaaaagaagaagaacagcgaattaagattgcttttgatgtccgtcgccggattcgtgtctggaaggtttttgaattctctccagttgtgaaaccggagctcacttttatctttgagaaagtcaagggcttttgtcatgattgcgggttatttgttcatgatgccctaggttgtgataagatgctgattaaggagaaggaggaaattcaggctaacccaccggcgacggcgttggctggcttgtccttgacttcgggagtagatgttagccctaatcccttggatgtttctgggatggggttggggatggagaccggggttgatcggaattgtcatgctctggttacaattgagcaagcatcgggcttctctgatgctactgctggtagccatgtcgtggcgtcaaatcaaggggtattgagctccaagctattgggtaaggccctattgctggaccaggttttggttggcatcacaacagcaaagggattgaacactgctattccacttcccatcatcccaactgagggttactcgaaatcattggaactgttttctgcctcggtagggactggtaaggaggctgctagggtggagttctcctcccttcaagtggtgccagttggaaggaaaagaaaagcggcgactagcttggctcaatttggtaagaagtctttggctcttcctgactcaacgtttgaagaggaggagaatgtttctttggtcctgcaatataaaaatggtaagttggtggtttcgccaaagaagaagaagattgggcgtcctaagggaagtaaaaacagaattaagaatgcagatgaacaagaagtgaaaaagcttcgaaggtataagcgtcgtggaaaacccttgatggatgagggtgaggcagttcagatggtgatgccttctgaagcagagggacaggtggaaggtgatgtgtcaccttctatagctagtttagtttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 Exo_endo_phos_2 RNase_H RVT_1 zf-CCHC_4

Protein Analysis

380

Amino Acids

41.23

Weight (kDa)

9.23

Isoelectric Point (pI)

40.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 118
AccB1I GGYRCC 2 cut(s) 46, 793
AccB7I CCANNNNNTGG 2 cut(s) 574, 640
AciI CCGC 3 cut(s) 77, 321, 818
AclI AACGTT 1 cut(s) 872
AclWI GGATC 3 cut(s) 139, 155, 168
AcsI RAATTY 2 cut(s) 251, 381
AcuI CTGAAG 1 cut(s) 1107
AcyI GRCGYC 2 cut(s) 578, 958
AfiI CCNNNNNNNGG 9 cut(s) 144, 145, 574, 628, 640, 703, 704, 744, 790
AgsI TTSAA 5 cut(s) 55, 251, 670, 788, 878
AjnI CCWGG 2 cut(s) 68, 633
AjuI GAANNNNNNNTTGG 2 cut(s) 881, 913
AluBI AGCT 6 cut(s) 277, 600, 607, 828, 1015, 1130
AluI AGCT 6 cut(s) 277, 600, 607, 828, 1015, 1130
Alw21I GWGCWC 3 cut(s) 153, 279, 602
Alw26I GTCTC 1 cut(s) 482
AlwI GGATC 3 cut(s) 139, 155, 168
AoxI GGCC 2 cut(s) 25, 618
ApeKI GCWGC 1 cut(s) 761
ApoI RAATTY 2 cut(s) 251, 381
ArsI GACNNNNNNTTYG 2 cut(s) 857, 889
AspA2I CCTAGG 1 cut(s) 343
AspS9I GGNCC 3 cut(s) 619, 631, 901
AsuC2I CCSGG 1 cut(s) 493
AsuHPI GGTGA 4 cut(s) 1070, 1087, 1110, 1121
AsuII TTCGAA 1 cut(s) 1018
AvaII GGWCC 2 cut(s) 631, 901
AvrII CCTAGG 1 cut(s) 343
AxyI CCTNAGG 1 cut(s) 963
BamHI GGATCC 1 cut(s) 160
BanI GGYRCC 2 cut(s) 46, 793
BanII GRGCYC 2 cut(s) 279, 602
Bbv12I GWGCWC 3 cut(s) 153, 279, 602
BbvI GCAGC 1 cut(s) 748
BccI CCATC 7 cut(s) 37, 55, 466, 478, 698, 1042, 1066
BceAI ACGGC 2 cut(s) 40, 420
BciT130I CCWGG 2 cut(s) 70, 635
BcnI CCSGG 1 cut(s) 493
BcoDI GTCTC 1 cut(s) 482
BfaI CTAG 4 cut(s) 344, 765, 825, 1131
BfmI CTRYAG 1 cut(s) 1125
BisI GCNGC 2 cut(s) 762, 819
BlnI CCTAGG 1 cut(s) 343
BlsI GCNGC 2 cut(s) 763, 820
Bme1390I CCNGG 3 cut(s) 70, 493, 635
Bme18I GGWCC 2 cut(s) 631, 901
BmgT120I GGNCC 3 cut(s) 619, 631, 901
BmiI GGNNCC 3 cut(s) 48, 162, 795
BmrFI CCNGG 3 cut(s) 70, 493, 635
BmsI GCATC 6 cut(s) 328, 348, 541, 545, 657, 1068
BplI GAGNNNNNCTC 4 cut(s) 695, 727, 764, 796
BpmI CTGGAG 1 cut(s) 243
Bpu14I TTCGAA 1 cut(s) 1018
BpuMI CCSGG 1 cut(s) 493
BsaHI GRCGYC 2 cut(s) 578, 958
BsaI GGTCTC 1 cut(s) 482
BsaJI CCNNGG 7 cut(s) 69, 123, 139, 343, 456, 492, 738
BsaWI WCCGGW 2 cut(s) 153, 271
BsaXI ACNNNNNCTCC 2 cut(s) 426, 456
Bsc4I CCNNNNNNNGG 9 cut(s) 144, 145, 574, 628, 640, 703, 704, 744, 790
Bse118I RCCGGY 1 cut(s) 397
Bse1I ACTGG 4 cut(s) 35, 260, 754, 797
Bse21I CCTNAGG 1 cut(s) 963
BseBI CCWGG 2 cut(s) 70, 635
BseDI CCNNGG 7 cut(s) 69, 123, 139, 343, 456, 492, 738
BseGI GGATG 5 cut(s) 466, 477, 489, 693, 1057
BseLI CCNNNNNNNGG 9 cut(s) 144, 145, 574, 628, 640, 703, 704, 744, 790
BseMII CTCAG 3 cut(s) 20, 92, 693
BseNI ACTGG 4 cut(s) 35, 260, 754, 797
BseRI GAGGAG 3 cut(s) 769, 896, 899
BseXI GCAGC 1 cut(s) 748
BshFI GGCC 2 cut(s) 27, 620
BshNI GGYRCC 2 cut(s) 46, 793
BsiHKAI GWGCWC 3 cut(s) 153, 279, 602
BsiSI CCGG 5 cut(s) 154, 226, 272, 398, 492
BslFI GGGAC 3 cut(s) 99, 760, 1110
BslI CCNNNNNNNGG 9 cut(s) 144, 145, 574, 628, 640, 703, 704, 744, 790
BsmAI GTCTC 1 cut(s) 482
BsmFI GGGAC 3 cut(s) 99, 760, 1110
BsmI GAATGC 1 cut(s) 994
BsnI GGCC 2 cut(s) 27, 620
Bso31I GGTCTC 1 cut(s) 482
Bsp119I TTCGAA 1 cut(s) 1018
Bsp1286I GDGCHC 3 cut(s) 153, 279, 602
Bsp143I GATC 3 cut(s) 131, 160, 499
Bsp19I CCATGG 1 cut(s) 123
BspACI CCGC 3 cut(s) 77, 321, 818
BspANI GGCC 2 cut(s) 27, 620
BspCNI CTCAG 3 cut(s) 21, 93, 694
BspHI TCATGA 2 cut(s) 313, 334
BspLI GGNNCC 3 cut(s) 48, 162, 795
BspPI GGATC 3 cut(s) 139, 155, 168
BspQI GCTCTTC 1 cut(s) 864
BspT104I TTCGAA 1 cut(s) 1018
BspT107I GGYRCC 2 cut(s) 46, 793
BspTNI GGTCTC 1 cut(s) 482
BsrFI RCCGGY 1 cut(s) 397
BsrI ACTGG 4 cut(s) 35, 260, 754, 797
BssAI RCCGGY 1 cut(s) 397
BssECI CCNNGG 7 cut(s) 69, 123, 139, 343, 456, 492, 738
BssMI GATC 3 cut(s) 131, 160, 499
BssNI GRCGYC 2 cut(s) 578, 958
BssT1I CCWWGG 3 cut(s) 123, 343, 456
Bst2UI CCWGG 2 cut(s) 70, 635
Bst4CI ACNGT 2 cut(s) 115, 729
Bst6I CTCTTC 2 cut(s) 864, 873
BstACI GRCGYC 2 cut(s) 578, 958
BstBI TTCGAA 1 cut(s) 1018
BstC8I GCNNGC 2 cut(s) 415, 534
BstDEI CTNAG 4 cut(s) 29, 101, 702, 963
BstDSI CCRYGG 1 cut(s) 123
BstF5I GGATG 5 cut(s) 466, 477, 489, 693, 1057
BstKTI GATC 3 cut(s) 134, 163, 502
BstMAI GTCTC 1 cut(s) 482
BstMBI GATC 3 cut(s) 131, 160, 499
BstNI CCWGG 2 cut(s) 70, 635
BstSCI CCNGG 3 cut(s) 68, 491, 633
BstSFI CTRYAG 1 cut(s) 1125
BstV1I GCAGC 1 cut(s) 748
BstX2I RGATCY 1 cut(s) 160
BstXI CCANNNNNNTGG 1 cut(s) 610
BstYI RGATCY 1 cut(s) 160
Bsu36I CCTNAGG 1 cut(s) 963
BsuRI GGCC 2 cut(s) 27, 620
BtgI CCRYGG 1 cut(s) 123
BtsCI GGATG 5 cut(s) 466, 477, 489, 693, 1057
BtsI GCAGTG 1 cut(s) 672
BtsIMutI CAGTG 1 cut(s) 672
Cac8I GCNNGC 2 cut(s) 415, 534
CciI TCATGA 2 cut(s) 313, 334
Cfr10I RCCGGY 1 cut(s) 397
Cfr13I GGNCC 3 cut(s) 619, 631, 901
CseI GACGC 3 cut(s) 567, 947, 1019
CsiI ACCWGGT 1 cut(s) 633
CviAII CATG 6 cut(s) 58, 124, 314, 335, 512, 569
DdeI CTNAG 4 cut(s) 29, 101, 702, 963
DpnI GATC 3 cut(s) 133, 162, 501
DpnII GATC 3 cut(s) 131, 160, 499
DrdI GACNNNNNNGTC 1 cut(s) 118
DseDI GACNNNNNNGTC 1 cut(s) 118
Eam1104I CTCTTC 2 cut(s) 864, 873
EarI CTCTTC 2 cut(s) 864, 873
Ecl136II GAGCTC 2 cut(s) 277, 600
Eco130I CCWWGG 3 cut(s) 123, 343, 456
Eco24I GRGCYC 2 cut(s) 279, 602
Eco31I GGTCTC 1 cut(s) 482
Eco47I GGWCC 2 cut(s) 631, 901
Eco53kI GAGCTC 2 cut(s) 277, 600
Eco57I CTGAAG 1 cut(s) 1107
Eco81I CCTNAGG 1 cut(s) 963
EcoICRI GAGCTC 2 cut(s) 277, 600
EcoO109I RGGNCCY 1 cut(s) 619
EcoRI GAATTC 1 cut(s) 251
EcoRII CCWGG 2 cut(s) 68, 633
EcoT14I CCWWGG 3 cut(s) 123, 343, 456
EcoT38I GRGCYC 2 cut(s) 279, 602
ErhI CCWWGG 3 cut(s) 123, 343, 456
FaeI CATG 6 cut(s) 61, 127, 317, 338, 515, 572
FaqI GGGAC 3 cut(s) 99, 760, 1110
FatI CATG 6 cut(s) 57, 123, 313, 334, 511, 568
FauI CCCGC 1 cut(s) 314
Fnu4HI GCNGC 2 cut(s) 762, 819
FokI GGATG 5 cut(s) 473, 484, 496, 680, 1064
FriOI GRGCYC 2 cut(s) 279, 602
Fsp4HI GCNGC 2 cut(s) 762, 819
FspBI CTAG 4 cut(s) 344, 765, 825, 1131
GluI GCNGC 2 cut(s) 762, 819
GsuI CTGGAG 1 cut(s) 243
HaeIII GGCC 2 cut(s) 27, 620
HapII CCGG 5 cut(s) 154, 226, 272, 398, 492
HgaI GACGC 3 cut(s) 567, 947, 1019
Hin1I GRCGYC 2 cut(s) 578, 958
Hin1II CATG 6 cut(s) 61, 127, 317, 338, 515, 572
HindIII AAGCTT 1 cut(s) 1013
HinfI GANTC 3 cut(s) 31, 229, 866
HpaII CCGG 5 cut(s) 154, 226, 272, 398, 492
HphI GGTGA 4 cut(s) 1070, 1087, 1110, 1121
Hpy188I TCNGA 6 cut(s) 102, 143, 504, 550, 1071, 1087
Hpy188III TCNNGA 5 cut(s) 238, 314, 335, 432, 863
Hpy99I CGWCG 3 cut(s) 225, 406, 1035
HpyAV CCTTC 9 cut(s) 138, 235, 367, 794, 798, 1014, 1092, 1100, 1131
HpyCH4III ACNGT 2 cut(s) 115, 729
HpyCH4IV ACGT 1 cut(s) 872
HpyCH4V TGCA 2 cut(s) 907, 992
HpyF3I CTNAG 4 cut(s) 29, 101, 702, 963
HpySE526I ACGT 1 cut(s) 872
Hsp92I GRCGYC 2 cut(s) 578, 958
Hsp92II CATG 6 cut(s) 61, 127, 317, 338, 515, 572
Kzo9I GATC 3 cut(s) 131, 160, 499
LguI GCTCTTC 1 cut(s) 864
LmnI GCTCC 3 cut(s) 156, 274, 605
Lsp1109I GCAGC 1 cut(s) 748
LweI GCATC 6 cut(s) 328, 348, 541, 545, 657, 1068
MabI ACCWGGT 1 cut(s) 633
MaeI CTAG 4 cut(s) 344, 765, 825, 1131
MaeII ACGT 1 cut(s) 872
MaeIII GTNAC 3 cut(s) 520, 707, 1116
MalI GATC 3 cut(s) 133, 162, 501
MboI GATC 3 cut(s) 131, 160, 499
MboII GAAGA 7 cut(s) 197, 200, 851, 890, 955, 958, 961
MfeI CAATTG 1 cut(s) 525
MflI RGATCY 1 cut(s) 160
MhlI GDGCHC 3 cut(s) 153, 279, 602
MluCI AATT 7 cut(s) 198, 251, 381, 505, 525, 836, 981
MlyI GAGTC 2 cut(s) 40, 860
MmeI TCCRAC 2 cut(s) 138, 781
MseI TTAA 5 cut(s) 81, 201, 366, 984, 1141
MspI CCGG 5 cut(s) 154, 226, 272, 398, 492
MspR9I CCNGG 3 cut(s) 70, 493, 635
MunI CAATTG 1 cut(s) 525
Mva1269I GAATGC 1 cut(s) 994
MvaI CCWGG 2 cut(s) 70, 635
NciI CCSGG 1 cut(s) 493
NcoI CCATGG 1 cut(s) 123
NdeII GATC 3 cut(s) 131, 160, 499
NlaIII CATG 6 cut(s) 61, 127, 317, 338, 515, 572
NlaIV GGNNCC 3 cut(s) 48, 162, 795
NmuCI GTSAC 1 cut(s) 1116
NspV TTCGAA 1 cut(s) 1018
PagI TCATGA 2 cut(s) 313, 334
PciSI GCTCTTC 1 cut(s) 864
PcsI WCGNNNNNNNCGW 1 cut(s) 229
PctI GAATGC 1 cut(s) 994
PfeI GAWTC 1 cut(s) 229
PflMI CCANNNNNTGG 2 cut(s) 574, 640
PkrI GCNGC 2 cut(s) 763, 820
PleI GAGTC 2 cut(s) 39, 860
PpsI GAGTC 2 cut(s) 39, 860
Psp124BI GAGCTC 2 cut(s) 279, 602
Psp1406I AACGTT 1 cut(s) 872
Psp6I CCWGG 2 cut(s) 68, 633
PspGI CCWGG 2 cut(s) 68, 633
PspN4I GGNNCC 3 cut(s) 48, 162, 795
PspPI GGNCC 3 cut(s) 619, 631, 901
PsuI RGATCY 1 cut(s) 160
SacI GAGCTC 2 cut(s) 279, 602
SapI GCTCTTC 1 cut(s) 864
SaqAI TTAA 5 cut(s) 81, 201, 366, 984, 1141
SatI GCNGC 2 cut(s) 762, 819
Sau3AI GATC 3 cut(s) 131, 160, 499
Sau96I GGNCC 3 cut(s) 619, 631, 901
SchI GAGTC 2 cut(s) 40, 860
ScrFI CCNGG 3 cut(s) 70, 493, 635
SduI GDGCHC 3 cut(s) 153, 279, 602
SexAI ACCWGGT 1 cut(s) 633
SfaNI GCATC 6 cut(s) 328, 348, 541, 545, 657, 1068
SfcI CTRYAG 1 cut(s) 1125
SfuI TTCGAA 1 cut(s) 1018
SgrAI CRCCGGYG 1 cut(s) 397
SinI GGWCC 2 cut(s) 631, 901
Sse9I AATT 7 cut(s) 198, 251, 381, 505, 525, 836, 981
SsiI CCGC 3 cut(s) 77, 321, 818
SspMI CTAG 4 cut(s) 344, 765, 825, 1131
SstI GAGCTC 2 cut(s) 279, 602
StyD4I CCNGG 3 cut(s) 68, 491, 633
StyI CCWWGG 3 cut(s) 123, 343, 456
TaaI ACNGT 2 cut(s) 115, 729
TaiI ACGT 1 cut(s) 875
TaqI TCGA 3 cut(s) 134, 713, 1018
TasI AATT 7 cut(s) 198, 251, 381, 505, 525, 836, 981
TauI GCSGC 1 cut(s) 821
TfiI GAWTC 1 cut(s) 229
Tru1I TTAA 5 cut(s) 81, 201, 366, 984, 1141
Tru9I TTAA 5 cut(s) 81, 201, 366, 984, 1141
TscAI CASTG 1 cut(s) 679
TseFI GTSAC 1 cut(s) 1116
TseI GCWGC 1 cut(s) 761
Tsp45I GTSAC 1 cut(s) 1116
TspDTI ATGAA 2 cut(s) 323, 1011
TspGWI ACGGA 1 cut(s) 209
TspRI CASTG 1 cut(s) 679
Van91I CCANNNNNTGG 2 cut(s) 574, 640
VpaK11BI GGWCC 2 cut(s) 631, 901
XapI RAATTY 2 cut(s) 251, 381
XcmI CCANNNNNNNNNTGG 1 cut(s) 641
XmaJI CCTAGG 1 cut(s) 343
XspI CTAG 4 cut(s) 344, 765, 825, 1131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.