Rmu_sc0006069.1_g000002

Agenet domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006069.1
OG0002343
Physical Location & Seq
Reverse (-)
3884 .. 5614
1731 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1296 bp
atggttgttgttcgctggtttcacaaagttgatgaggttggtatggtcttgcctctcaattttaatcatagagagattttcttctctctctgtcaccaacatctcagtattgaatggattgatggattggctactgtcctcagccccgtgcattttgagaaatttctgaaagaggcgaagcaaacacagctggaaccctttgtatgtcataaacagtttgaaaatgatgatgtaaagcccttcgacattactcaagttgaaggttattggaaacaggagaacttagatacatgcacacagttatcccttcaaagaggtgaaaaacaaaccctgccgcagtatctagcagaaggttcccaggaagtcctgtcccaagatagtggcattagagggtgttggtttagagcattgattatcaagaagcataaagataaagttaaggtgcaatatcaagatattcaggatgcagctgatgaagctaacaaacttgaggaatggattttagcgtcaaagattgcagctcctgatcaattggggcttcggctttctgataggccaagtattcggccatgtataaagtcaaataaaggtagagtttcatggtctgttggtgttgcgagtgttgttgatgtctggaggcatgatggttggtgggaaggcatagtacttcaaaaggaatatgaagacagacttcatgtatacttcccagttttgaaacaacttctgttctcgtattctatagtgacaatgatgccaagttcgacttattctgttattggagagaatcaggttttgattgcggggcgtagtgaagtgcgacattctcaagagtggctggggaaagattgggcttatatgaaggacaggtcagaccttgtggtctcaatatcaagtactttagaaaccaagaaaactgttggaaactcatttgatggcatgttaggactgtctgaaatcagtgatagcagagagttgaagaaacttgaaacatctgctctttcctctgataatgacaaggatgaaaaagtcaatgaagtcaataaggttccagatcttttgaaggatgatctctttgcccagccaaagtggaagtctttgaggaagagaagacatggtaatggaagctctgcccgaaagctgcattttggtagtgatggtaaaagcacctctggcctcatgggatcaaaatcttgtggaagatatttgattccatcatctctcatggttgaccacgagaactgcaaatattttggggattctcttttcagtttgtcagttgtgccgccgtctttctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Agenet BAH

Protein Analysis

431

Amino Acids

49.16

Weight (kDa)

6.68

Isoelectric Point (pI)

39.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Agenet PF05641 121 - 191 7.5e-16 Agenet domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 878
AccI GTMKAC 1 cut(s) 699
AciI CCGC 3 cut(s) 335, 800, 1283
AclWI GGATC 1 cut(s) 1189
AcoI YGGCCR 1 cut(s) 566
AcsI RAATTY 1 cut(s) 161
AfaI GTAC 2 cut(s) 666, 895
AgsI TTSAA 9 cut(s) 113, 221, 260, 311, 671, 715, 976, 986, 1060
AjnI CCWGG 1 cut(s) 357
AluBI AGCT 6 cut(s) 190, 470, 479, 521, 1125, 1138
AluI AGCT 6 cut(s) 190, 470, 479, 521, 1125, 1138
Alw26I GTCTC 1 cut(s) 886
AlwI GGATC 1 cut(s) 1189
AlwNI CAGNNNCTG 1 cut(s) 524
AoxI GGCC 3 cut(s) 554, 566, 1171
ApeKI GCWGC 3 cut(s) 467, 518, 1138
ApoI RAATTY 1 cut(s) 161
ArsI GACNNNNNNTTYG 2 cut(s) 1076, 1108
AsuHPI GGTGA 2 cut(s) 86, 329
BarI GAAGNNNNNNTAC 2 cut(s) 648, 680
BauI CACGAG 1 cut(s) 1232
BbsI GAAGAC 2 cut(s) 690, 1114
BbvCI CCTCAGC 1 cut(s) 140
BbvI GCAGC 3 cut(s) 479, 530, 1125
BccI CCATC 5 cut(s) 116, 638, 926, 1148, 1219
BceAI ACGGC 1 cut(s) 1270
BciT130I CCWGG 1 cut(s) 359
BclI TGATCA 1 cut(s) 526
BcoDI GTCTC 1 cut(s) 886
BfaI CTAG 2 cut(s) 344, 1294
BfmI CTRYAG 1 cut(s) 738
BglII AGATCT 1 cut(s) 1051
BisI GCNGC 5 cut(s) 335, 468, 519, 1139, 1283
BlsI GCNGC 5 cut(s) 336, 469, 520, 1140, 1284
BmcAI AGTACT 2 cut(s) 666, 895
Bme1390I CCNGG 1 cut(s) 359
BmiI GGNNCC 3 cut(s) 195, 355, 1047
BmrFI CCNGG 1 cut(s) 359
BmrI ACTGGG 1 cut(s) 701
BmsI GCATC 2 cut(s) 454, 741
BmuI ACTGGG 1 cut(s) 701
BpiI GAAGAC 2 cut(s) 690, 1114
BpmI CTGGAG 1 cut(s) 655
Bpu10I CCTNAGC 1 cut(s) 140
BpuEI CTTGAG 3 cut(s) 237, 509, 810
BsaBI GATNNNNATC 1 cut(s) 1186
BsaI GGTCTC 1 cut(s) 886
BsaJI CCNNGG 1 cut(s) 357
Bse1I ACTGG 1 cut(s) 707
Bse8I GATNNNNATC 1 cut(s) 1186
BseBI CCWGG 1 cut(s) 359
BseDI CCNNGG 1 cut(s) 357
BseGI GGATG 3 cut(s) 469, 1024, 1069
BseJI GATNNNNATC 1 cut(s) 1186
BseMII CTCAG 2 cut(s) 118, 154
BseNI ACTGG 1 cut(s) 707
BseXI GCAGC 3 cut(s) 479, 530, 1125
BseYI CCCAGC 2 cut(s) 835, 1077
BshFI GGCC 3 cut(s) 556, 568, 1173
BslFI GGGAC 1 cut(s) 355
BsmAI GTCTC 1 cut(s) 886
BsmFI GGGAC 1 cut(s) 355
BsnI GGCC 3 cut(s) 556, 568, 1173
Bso31I GGTCTC 1 cut(s) 886
Bsp143I GATC 4 cut(s) 526, 1051, 1066, 1181
BspACI CCGC 3 cut(s) 335, 800, 1283
BspANI GGCC 3 cut(s) 556, 568, 1173
BspCNI CTCAG 2 cut(s) 117, 153
BspLI GGNNCC 3 cut(s) 195, 355, 1047
BspPI GGATC 1 cut(s) 1189
BspTNI GGTCTC 1 cut(s) 886
BsrI ACTGG 1 cut(s) 707
BssECI CCNNGG 1 cut(s) 357
BssMI GATC 4 cut(s) 526, 1051, 1066, 1181
BssNAI GTATAC 1 cut(s) 700
BssSI CACGAG 1 cut(s) 1232
Bst1107I GTATAC 1 cut(s) 700
Bst2BI CACGAG 1 cut(s) 1232
Bst2UI CCWGG 1 cut(s) 359
Bst4CI ACNGT 5 cut(s) 136, 216, 300, 916, 948
Bst6I CTCTTC 1 cut(s) 1097
BstDEI CTNAG 3 cut(s) 104, 140, 283
BstF5I GGATG 3 cut(s) 469, 1024, 1069
BstKTI GATC 4 cut(s) 529, 1054, 1069, 1184
BstMAI GTCTC 1 cut(s) 886
BstMBI GATC 4 cut(s) 526, 1051, 1066, 1181
BstMWI GCNNNNNNNGC 3 cut(s) 187, 476, 1170
BstNI CCWGG 1 cut(s) 359
BstNSI RCATGY 2 cut(s) 294, 940
BstSCI CCNGG 1 cut(s) 357
BstSFI CTRYAG 1 cut(s) 738
BstV1I GCAGC 3 cut(s) 479, 530, 1125
BstV2I GAAGAC 2 cut(s) 690, 1114
BstX2I RGATCY 1 cut(s) 1051
BstXI CCANNNNNNTGG 1 cut(s) 380
BstYI RGATCY 1 cut(s) 1051
BstZ17I GTATAC 1 cut(s) 700
BsuRI GGCC 3 cut(s) 556, 568, 1173
BtsCI GGATG 3 cut(s) 469, 1024, 1069
BtsIMutI CAGTG 1 cut(s) 964
CaiI CAGNNNCTG 1 cut(s) 524
CseI GACGC 1 cut(s) 495
Csp6I GTAC 2 cut(s) 665, 894
CviAII CATG 9 cut(s) 291, 570, 600, 641, 695, 937, 1112, 1177, 1222
CviQI GTAC 2 cut(s) 665, 894
DdeI CTNAG 3 cut(s) 104, 140, 283
DpnI GATC 4 cut(s) 528, 1053, 1068, 1183
DpnII GATC 4 cut(s) 526, 1051, 1066, 1181
DrdI GACNNNNNNGTC 1 cut(s) 878
DseDI GACNNNNNNGTC 1 cut(s) 878
EaeI YGGCCR 1 cut(s) 566
Eam1104I CTCTTC 1 cut(s) 1097
EarI CTCTTC 1 cut(s) 1097
Eco31I GGTCTC 1 cut(s) 886
EcoRII CCWGG 1 cut(s) 357
FaeI CATG 9 cut(s) 294, 573, 603, 644, 698, 940, 1115, 1180, 1225
FalI AAGNNNNNCTT 4 cut(s) 675, 707, 748, 780
FaqI GGGAC 1 cut(s) 355
FatI CATG 9 cut(s) 290, 569, 599, 640, 694, 936, 1111, 1176, 1221
FauI CCCGC 1 cut(s) 793
FbaI TGATCA 1 cut(s) 526
FblI GTMKAC 1 cut(s) 699
Fnu4HI GCNGC 5 cut(s) 335, 468, 519, 1139, 1283
FokI GGATG 3 cut(s) 476, 1031, 1076
Fsp4HI GCNGC 5 cut(s) 335, 468, 519, 1139, 1283
FspBI CTAG 2 cut(s) 344, 1294
GluI GCNGC 5 cut(s) 335, 468, 519, 1139, 1283
GsaI CCCAGC 2 cut(s) 839, 1081
GsuI CTGGAG 1 cut(s) 655
HaeIII GGCC 3 cut(s) 556, 568, 1173
HgaI GACGC 1 cut(s) 495
Hin1II CATG 9 cut(s) 294, 573, 603, 644, 698, 940, 1115, 1180, 1225
HincII GTYRAC 1 cut(s) 1228
HindII GTYRAC 1 cut(s) 1228
HinfI GANTC 3 cut(s) 784, 1207, 1256
HphI GGTGA 2 cut(s) 86, 329
Hpy166II GTNNAC 2 cut(s) 700, 1228
Hpy188I TCNGA 5 cut(s) 168, 550, 871, 952, 1006
Hpy188III TCNNGA 7 cut(s) 418, 452, 461, 524, 634, 827, 1049
Hpy8I GTNNAC 2 cut(s) 700, 1228
HpyAV CCTTC 7 cut(s) 250, 254, 317, 344, 650, 853, 1054
HpyCH4III ACNGT 5 cut(s) 136, 216, 300, 916, 948
HpyCH4V TGCA 7 cut(s) 151, 294, 445, 467, 518, 1141, 1242
HpyF10VI GCNNNNNNNGC 3 cut(s) 187, 476, 1170
HpyF3I CTNAG 3 cut(s) 104, 140, 283
Hsp92II CATG 9 cut(s) 294, 573, 603, 644, 698, 940, 1115, 1180, 1225
Ksp22I TGATCA 1 cut(s) 526
Kzo9I GATC 4 cut(s) 526, 1051, 1066, 1181
LmnI GCTCC 1 cut(s) 526
Lsp1109I GCAGC 3 cut(s) 479, 530, 1125
LweI GCATC 2 cut(s) 454, 741
MaeI CTAG 2 cut(s) 344, 1294
MaeIII GTNAC 2 cut(s) 92, 742
MalI GATC 4 cut(s) 528, 1053, 1068, 1183
MboI GATC 4 cut(s) 526, 1051, 1066, 1181
MboII GAAGA 6 cut(s) 73, 695, 988, 1114, 1119, 1209
MfeI CAATTG 1 cut(s) 530
MflI RGATCY 1 cut(s) 1051
MluCI AATT 3 cut(s) 58, 161, 530
MmeI TCCRAC 1 cut(s) 898
MseI TTAA 2 cut(s) 63, 438
MslI CAYNNNNRTG 1 cut(s) 1116
MspA1I CMGCKG 2 cut(s) 190, 470
MspR9I CCNGG 1 cut(s) 359
MunI CAATTG 1 cut(s) 530
MvaI CCWGG 1 cut(s) 359
MwoI GCNNNNNNNGC 3 cut(s) 187, 476, 1170
NdeII GATC 4 cut(s) 526, 1051, 1066, 1181
NlaIII CATG 9 cut(s) 294, 573, 603, 644, 698, 940, 1115, 1180, 1225
NlaIV GGNNCC 3 cut(s) 195, 355, 1047
NmuCI GTSAC 2 cut(s) 92, 742
NspI RCATGY 2 cut(s) 294, 940
PfeI GAWTC 3 cut(s) 784, 1207, 1256
PkrI GCNGC 5 cut(s) 336, 469, 520, 1140, 1284
Psp6I CCWGG 1 cut(s) 357
PspFI CCCAGC 2 cut(s) 835, 1077
PspGI CCWGG 1 cut(s) 357
PspN4I GGNNCC 3 cut(s) 195, 355, 1047
PstNI CAGNNNCTG 1 cut(s) 524
PsuI RGATCY 1 cut(s) 1051
PvuII CAGCTG 2 cut(s) 190, 470
RsaI GTAC 2 cut(s) 666, 895
RsaNI GTAC 2 cut(s) 665, 894
RseI CAYNNNNRTG 1 cut(s) 1116
SaqAI TTAA 2 cut(s) 63, 438
SatI GCNGC 5 cut(s) 335, 468, 519, 1139, 1283
Sau3AI GATC 4 cut(s) 526, 1051, 1066, 1181
ScaI AGTACT 2 cut(s) 666, 895
ScrFI CCNGG 1 cut(s) 359
SfaNI GCATC 2 cut(s) 454, 741
SfcI CTRYAG 1 cut(s) 738
SmiMI CAYNNNNRTG 1 cut(s) 1116
SmlI CTYRAG 3 cut(s) 252, 488, 825
SmoI CTYRAG 3 cut(s) 252, 488, 825
Sse9I AATT 3 cut(s) 58, 161, 530
SsiI CCGC 3 cut(s) 335, 800, 1283
SspI AATATT 1 cut(s) 1247
SspMI CTAG 2 cut(s) 344, 1294
StyD4I CCNGG 1 cut(s) 357
TaaI ACNGT 5 cut(s) 136, 216, 300, 916, 948
TaqI TCGA 2 cut(s) 243, 761
TasI AATT 3 cut(s) 58, 161, 530
TatI WGTACW 2 cut(s) 664, 893
TauI GCSGC 2 cut(s) 337, 1285
TfiI GAWTC 3 cut(s) 784, 1207, 1256
Tru1I TTAA 2 cut(s) 63, 438
Tru9I TTAA 2 cut(s) 63, 438
TscAI CASTG 1 cut(s) 964
TseFI GTSAC 2 cut(s) 92, 742
TseI GCWGC 3 cut(s) 467, 518, 1138
Tsp45I GTSAC 2 cut(s) 92, 742
TspDTI ATGAA 7 cut(s) 489, 588, 683, 696, 872, 1035, 1047
TspRI CASTG 1 cut(s) 964
XapI RAATTY 1 cut(s) 161
XceI RCATGY 2 cut(s) 294, 940
XmiI GTMKAC 1 cut(s) 699
XspI CTAG 2 cut(s) 344, 1294
ZrmI AGTACT 2 cut(s) 666, 895
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.