Rroxscaffold_3G00234330

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0002343
Physical Location & Seq
Forward (+)
20618969 .. 20622624
3656 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00234330.1

Sequence Viewer

Length: 357 bp
ATGATTTATCCGATTCAATTTTTTTGCTTTCCCCAAGTTGAGCCTCCTCCCTCACATGCAAAGCCCAGCCTTCTTCTTTTCTTGTTCACATCAAAATTGGGCAGAGAGAAAGGAGAACCTCGTTCAGCTCCTCCATTCCATGTTGCCACCATCAAAGGGAAACCTCTCCTAAAAAACCATCCCAGGCCTTCAAACAGGAGTATCCAAGCCGAGATTGTCATTCACCCCTCTCTTCCCACTCTTCCTCTCATTTCTGTGCATATCAGTCCGCTTGCATGCCCTGAAACACCTAGTTCGGGACCTCCGAGAAAAATTCTTTCTTCATTAAAGTTGTTCACCTTTGTCTCTTCTATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

13.0

Weight (kDa)

10.11

Isoelectric Point (pI)

59.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 269
AcsI RAATTY 1 cut(s) 312
AfiI CCNNNNNNNGG 2 cut(s) 156, 296
AgsI TTSAA 2 cut(s) 17, 192
AjnI CCWGG 1 cut(s) 182
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
Alw26I GTCTC 1 cut(s) 349
AoxI GGCC 1 cut(s) 185
ApoI RAATTY 1 cut(s) 312
AspS9I GGNCC 1 cut(s) 299
AsuHPI GGTGA 2 cut(s) 215, 328
AvaII GGWCC 1 cut(s) 299
BaeI ACNNNNGTAYC 2 cut(s) 184, 217
BccI CCATC 2 cut(s) 158, 186
BciT130I CCWGG 1 cut(s) 184
BciVI GTATCC 1 cut(s) 212
BcoDI GTCTC 1 cut(s) 349
BfaI CTAG 1 cut(s) 291
BfuI GTATCC 1 cut(s) 212
Bme1390I CCNGG 1 cut(s) 184
Bme18I GGWCC 1 cut(s) 299
BmgT120I GGNCC 1 cut(s) 299
BmiI GGNNCC 1 cut(s) 300
BmrFI CCNGG 1 cut(s) 184
BsaJI CCNNGG 1 cut(s) 182
Bsc4I CCNNNNNNNGG 2 cut(s) 156, 296
BseBI CCWGG 1 cut(s) 184
BseDI CCNNGG 1 cut(s) 182
BseGI GGATG 1 cut(s) 178
BseLI CCNNNNNNNGG 2 cut(s) 156, 296
BseRI GAGGAG 2 cut(s) 36, 120
BseYI CCCAGC 1 cut(s) 65
BshFI GGCC 1 cut(s) 187
BslFI GGGAC 1 cut(s) 312
BslI CCNNNNNNNGG 2 cut(s) 156, 296
BsmAI GTCTC 1 cut(s) 349
BsmFI GGGAC 1 cut(s) 312
BsnI GGCC 1 cut(s) 187
BspACI CCGC 1 cut(s) 269
BspANI GGCC 1 cut(s) 187
BspLI GGNNCC 1 cut(s) 300
BssECI CCNNGG 1 cut(s) 182
Bst2UI CCWGG 1 cut(s) 184
Bst6I CTCTTC 3 cut(s) 237, 246, 352
BstC8I GCNNGC 2 cut(s) 273, 277
BstF5I GGATG 1 cut(s) 178
BstMAI GTCTC 1 cut(s) 349
BstNI CCWGG 1 cut(s) 184
BstNSI RCATGY 2 cut(s) 59, 279
BstSCI CCNGG 1 cut(s) 182
BsuI GTATCC 1 cut(s) 212
BsuRI GGCC 1 cut(s) 187
BtsCI GGATG 1 cut(s) 178
Cac8I GCNNGC 2 cut(s) 273, 277
Cfr13I GGNCC 1 cut(s) 299
CviAII CATG 3 cut(s) 56, 140, 276
CviJI RGCY 6 cut(s) 43, 64, 69, 128, 187, 209
CviKI_1 RGCY 6 cut(s) 43, 64, 69, 128, 187, 209
Eam1104I CTCTTC 3 cut(s) 237, 246, 352
EarI CTCTTC 3 cut(s) 237, 246, 352
Eco147I AGGCCT 1 cut(s) 187
Eco47I GGWCC 1 cut(s) 299
EcoO109I RGGNCCY 1 cut(s) 299
EcoRII CCWGG 1 cut(s) 182
FaeI CATG 3 cut(s) 59, 143, 279
FaiI YATR 4 cut(s) 57, 141, 261, 277
FaqI GGGAC 1 cut(s) 312
FatI CATG 3 cut(s) 55, 139, 275
FokI GGATG 1 cut(s) 165
FspBI CTAG 1 cut(s) 291
GsaI CCCAGC 1 cut(s) 69
HaeIII GGCC 1 cut(s) 187
Hin1II CATG 3 cut(s) 59, 143, 279
HinfI GANTC 1 cut(s) 13
HphI GGTGA 2 cut(s) 215, 328
Hpy166II GTNNAC 2 cut(s) 87, 336
Hpy188I TCNGA 3 cut(s) 12, 306, 356
Hpy188III TCNNGA 1 cut(s) 297
Hpy8I GTNNAC 2 cut(s) 87, 336
HpyAV CCTTC 2 cut(s) 80, 198
HpyCH4V TGCA 3 cut(s) 59, 259, 275
Hsp92II CATG 3 cut(s) 59, 143, 279
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 5 cut(s) 79, 169, 181, 196, 294
MaeI CTAG 1 cut(s) 291
MboII GAAGA 5 cut(s) 65, 224, 233, 312, 339
MluCI AATT 3 cut(s) 17, 95, 312
MnlI CCTC 9 cut(s) 54, 57, 61, 129, 141, 174, 238, 255, 312
MseI TTAA 1 cut(s) 326
MslI CAYNNNNRTG 1 cut(s) 254
MspR9I CCNGG 1 cut(s) 184
MvaI CCWGG 1 cut(s) 184
NlaIII CATG 3 cut(s) 59, 143, 279
NlaIV GGNNCC 1 cut(s) 300
NmeAIII GCCGAG 1 cut(s) 235
NspI RCATGY 2 cut(s) 59, 279
PaeI GCATGC 1 cut(s) 279
PceI AGGCCT 1 cut(s) 187
PcsI WCGNNNNNNNCGW 1 cut(s) 302
PfeI GAWTC 1 cut(s) 13
PpuMI RGGWCCY 1 cut(s) 299
Psp5II RGGWCCY 1 cut(s) 299
Psp6I CCWGG 1 cut(s) 182
PspFI CCCAGC 1 cut(s) 65
PspGI CCWGG 1 cut(s) 182
PspN4I GGNNCC 1 cut(s) 300
PspPI GGNCC 1 cut(s) 299
PspPPI RGGWCCY 1 cut(s) 299
RseI CAYNNNNRTG 1 cut(s) 254
SaqAI TTAA 1 cut(s) 326
Sau96I GGNCC 1 cut(s) 299
ScrFI CCNGG 1 cut(s) 184
SetI ASST 6 cut(s) 121, 130, 166, 292, 304, 341
SinI GGWCC 1 cut(s) 299
SmiMI CAYNNNNRTG 1 cut(s) 254
SphI GCATGC 1 cut(s) 279
Sse9I AATT 3 cut(s) 17, 95, 312
SseBI AGGCCT 1 cut(s) 187
SsiI CCGC 1 cut(s) 269
SspMI CTAG 1 cut(s) 291
StuI AGGCCT 1 cut(s) 187
StyD4I CCNGG 1 cut(s) 182
TasI AATT 3 cut(s) 17, 95, 312
TfiI GAWTC 1 cut(s) 13
Tru1I TTAA 1 cut(s) 326
Tru9I TTAA 1 cut(s) 326
TspDTI ATGAA 1 cut(s) 312
VpaK11BI GGWCC 1 cut(s) 299
XapI RAATTY 1 cut(s) 312
XceI RCATGY 2 cut(s) 59, 279
XspI CTAG 1 cut(s) 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.