Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006592.1

Orthogroup ID

OG0005146

Physical Location & Seq

Genomic Coordinates Reverse (-)

10237 .. 11715

Gene Structure 1479 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006592.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 837 bp

atgggaaggcagccttgctgtgacaaacttggggttaagaaagggccatggacagccgaggaggataagaagctcatcaacttcattctcacaaatggccagtgttgctggagagccgtccccaagctcgctgggcttcgccgctgtggcaagagttgcagactccgttggaccaactatctccgtcccgacttgaagagaggcctccttacagaatctgaagaacagttggtcattgatctccatgctcgtctcggaaataggtggtccaagattgcagccagattgccagggaggactgataatgaaatcaagaatcactggaacacccacatcaagaaaaagctgcttagaatgggaattgatcccgtcacgcatgaacccctccacaaagatcaagatgacttgatcaacaaggaaactattatttcatcccatactaatcaagctaacaatatcttgcctcaatctacaactgaaaattcatcttcaaactcatcaccagctgagaattcatcatcaagctcatcaccaaatgaaaattcttctggagacgaccaatcgactttaattgatagcatttgcaacgttgacgagtcgttgatgaacagtctttgggtggatgaaactccgctaatcgatgcattgtggaacagtgatcaagtaccagatggaggaaattacatcgaaaatggcatgggagtgcaatctaattgggaggagaattgctcatggcttttggactgccaagactttggcgttcatgatttcggtgtggattgcttcatcgaaaccgaattaaatgccctcgacacattagggatggagaaaatttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

278

Amino Acids

31.22

Weight (kDa)

5.06

Isoelectric Point (pI)

53.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005146)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G22680
fragaria_vesca	FvH4_5g00480 FvH4_7g27910
malus_domestica	MD00G1104700.v1.1 MD04G1080600.v1.1 MD07G1256200.v1.1
prunus_persica	Prupe.2G280100_v2.0.a1 Prupe.5G077500_v2.0.a1
pyrus_communis	pycom01g19580 pycom04g07290 pycom07g22910
rosa_chinensis	RchiOBHm_Chr1g0374861 RchiOBHm_Chr7g0202031
rosa_laevigata	RLG00000003632 RLG00000026711
rosa_multiflora	Rmu_sc0004947.1_g000027 Rmu_sc0006592.1_g000003
rosa_roxburghii	Rroxscaffold_3G00254920 Rroxscaffold_4G00283220
rosa_rugosa	Rorug01G0385400 Rorug07G0067400
rosa_samantha	Rh1AG397000 Rh1BG360800 Rh1CG374500 Rh7AG194700 Rh7BG196200 Rh7CG206000 Rh7DG201400
rosa_wichuraiana	Rw1G035200 Rw7G017060

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	142, 632
AclI	AACGTT	1 cut(s)	588
AclWI	GGATC	1 cut(s)	359
AcoI	YGGCCR	1 cut(s)	97
AcsI	RAATTY	4 cut(s)	481, 511, 541, 831
AcuI	CTGAAG	1 cut(s)	240
AfaI	GTAC	1 cut(s)	666
AfiI	CCNNNNNNNGG	1 cut(s)	674
AgsI	TTSAA	2 cut(s)	196, 492
AjnI	CCWGG	1 cut(s)	289
AjuI	GAANNNNNNNTTGG	2 cut(s)	526, 558
AluBI	AGCT	6 cut(s)	73, 127, 346, 449, 506, 525
AluI	AGCT	6 cut(s)	73, 127, 346, 449, 506, 525
Alw26I	GTCTC	2 cut(s)	257, 546
AlwI	GGATC	1 cut(s)	359
AlwNI	CAGNNNCTG	1 cut(s)	218
AoxI	GGCC	3 cut(s)	44, 97, 202
ApeKI	GCWGC	3 cut(s)	10, 278, 346
ApoI	RAATTY	4 cut(s)	481, 511, 541, 831
AspS9I	GGNCC	3 cut(s)	44, 171, 267
AsuHPI	GGTGA	2 cut(s)	492, 522
AvaII	GGWCC	2 cut(s)	171, 267
BalI	TGGCCA	1 cut(s)	99
BbvI	GCAGC	3 cut(s)	22, 290, 333
BccI	CCATC	2 cut(s)	665, 817
BceAI	ACGGC	1 cut(s)	101
BcgI	CGANNNNNNTGC	2 cut(s)	785, 819
BciT130I	CCWGG	1 cut(s)	291
BclI	TGATCA	2 cut(s)	408, 658
BcoDI	GTCTC	2 cut(s)	257, 546
BglI	GCCNNNNNGGC	1 cut(s)	147
BisI	GCNGC	4 cut(s)	11, 142, 279, 347
BlsI	GCNGC	4 cut(s)	12, 143, 280, 348
Bme1390I	CCNGG	1 cut(s)	291
Bme18I	GGWCC	2 cut(s)	171, 267
BmgT120I	GGNCC	3 cut(s)	44, 171, 267
BmrFI	CCNGG	1 cut(s)	291
BmsI	GCATC	1 cut(s)	631
BplI	GAGNNNNNCTC	2 cut(s)	713, 745
BpmI	CTGGAG	2 cut(s)	130, 570
Bsa29I	ATCGAT	1 cut(s)	639
BsaJI	CCNNGG	3 cut(s)	47, 57, 290
Bsc4I	CCNNNNNNNGG	1 cut(s)	674
Bse1I	ACTGG	2 cut(s)	100, 326
BseBI	CCWGG	1 cut(s)	291
BseCI	ATCGAT	1 cut(s)	639
BseDI	CCNNGG	3 cut(s)	47, 57, 290
BseGI	GGATG	3 cut(s)	431, 628, 828
BseLI	CCNNNNNNNGG	1 cut(s)	674
BseMII	CTCAG	1 cut(s)	498
BseNI	ACTGG	2 cut(s)	100, 326
BseRI	GAGGAG	2 cut(s)	74, 734
BseXI	GCAGC	3 cut(s)	22, 290, 333
BseYI	CCCAGC	1 cut(s)	131
BshFI	GGCC	3 cut(s)	46, 99, 204
BshVI	ATCGAT	1 cut(s)	639
BslFI	GGGAC	2 cut(s)	104, 171
BslI	CCNNNNNNNGG	1 cut(s)	674
BsmAI	GTCTC	2 cut(s)	257, 546
BsmBI	CGTCTC	2 cut(s)	257, 546
BsmFI	GGGAC	2 cut(s)	104, 171
BsnI	GGCC	3 cut(s)	46, 99, 204
Bsp143I	GATC	5 cut(s)	238, 364, 394, 408, 658
Bsp19I	CCATGG	1 cut(s)	47
BspACI	CCGC	2 cut(s)	142, 632
BspANI	GGCC	3 cut(s)	46, 99, 204
BspCNI	CTCAG	1 cut(s)	499
BspDI	ATCGAT	1 cut(s)	639
BspHI	TCATGA	1 cut(s)	763
BspPI	GGATC	1 cut(s)	359
BsrI	ACTGG	2 cut(s)	100, 326
BssECI	CCNNGG	3 cut(s)	47, 57, 290
BssMI	GATC	5 cut(s)	238, 364, 394, 408, 658
BssT1I	CCWWGG	1 cut(s)	47
Bst2UI	CCWGG	1 cut(s)	291
Bst4CI	ACNGT	3 cut(s)	228, 611, 656
Bst6I	CTCTTC	1 cut(s)	191
BstAPI	GCANNNNNTGC	1 cut(s)	156
BstC8I	GCNNGC	1 cut(s)	129
BstDEI	CTNAG	2 cut(s)	350, 507
BstDSI	CCRYGG	1 cut(s)	47
BstF5I	GGATG	3 cut(s)	431, 628, 828
BstKTI	GATC	5 cut(s)	241, 367, 397, 411, 661
BstMAI	GTCTC	2 cut(s)	257, 546
BstMBI	GATC	5 cut(s)	238, 364, 394, 408, 658
BstMWI	GCNNNNNNNGC	4 cut(s)	105, 133, 147, 156
BstNI	CCWGG	1 cut(s)	291
BstSCI	CCNGG	1 cut(s)	289
BstV1I	GCAGC	3 cut(s)	22, 290, 333
BstXI	CCANNNNNNTGG	1 cut(s)	755
Bsu15I	ATCGAT	1 cut(s)	639
BsuRI	GGCC	3 cut(s)	46, 99, 204
BsuTUI	ATCGAT	1 cut(s)	639
BtgI	CCRYGG	1 cut(s)	47
BtsCI	GGATG	3 cut(s)	431, 628, 828
BtsIMutI	CAGTG	3 cut(s)	107, 319, 661
Cac8I	GCNNGC	1 cut(s)	129
CaiI	CAGNNNCTG	1 cut(s)	218
CciI	TCATGA	1 cut(s)	763
Cfr13I	GGNCC	3 cut(s)	44, 171, 267
ClaI	ATCGAT	1 cut(s)	639
Csp6I	GTAC	1 cut(s)	665
CviAII	CATG	6 cut(s)	48, 245, 377, 697, 732, 764
CviQI	GTAC	1 cut(s)	665
DdeI	CTNAG	2 cut(s)	350, 507
DpnI	GATC	5 cut(s)	240, 366, 396, 410, 660
DpnII	GATC	5 cut(s)	238, 364, 394, 408, 658
EaeI	YGGCCR	1 cut(s)	97
Eam1104I	CTCTTC	1 cut(s)	191
EarI	CTCTTC	1 cut(s)	191
Eco130I	CCWWGG	1 cut(s)	47
Eco147I	AGGCCT	1 cut(s)	204
Eco47I	GGWCC	2 cut(s)	171, 267
Eco57I	CTGAAG	1 cut(s)	240
EcoRI	GAATTC	1 cut(s)	511
EcoRII	CCWGG	1 cut(s)	289
EcoT14I	CCWWGG	1 cut(s)	47
EcoT22I	ATGCAT	1 cut(s)	646
ErhI	CCWWGG	1 cut(s)	47
Esp3I	CGTCTC	2 cut(s)	257, 546
FaeI	CATG	6 cut(s)	51, 248, 380, 700, 735, 767
FaiI	YATR	7 cut(s)	49, 246, 378, 438, 698, 733, 765
FalI	AAGNNNNNCTT	1 cut(s)	30
FaqI	GGGAC	2 cut(s)	104, 171
FatI	CATG	6 cut(s)	47, 244, 376, 696, 731, 763
FbaI	TGATCA	2 cut(s)	408, 658
Fnu4HI	GCNGC	4 cut(s)	11, 142, 279, 347
FokI	GGATG	2 cut(s)	418, 635
Fsp4HI	GCNGC	4 cut(s)	11, 142, 279, 347
GluI	GCNGC	4 cut(s)	11, 142, 279, 347
GsaI	CCCAGC	1 cut(s)	135
GsuI	CTGGAG	2 cut(s)	130, 570
HaeIII	GGCC	3 cut(s)	46, 99, 204
Hin1II	CATG	6 cut(s)	51, 248, 380, 700, 735, 767
HincII	GTYRAC	1 cut(s)	592
HindII	GTYRAC	1 cut(s)	592
HinfI	GANTC	4 cut(s)	162, 215, 316, 596
HphI	GGTGA	2 cut(s)	492, 522
Hpy166II	GTNNAC	1 cut(s)	592
Hpy188I	TCNGA	2 cut(s)	220, 257
Hpy188III	TCNNGA	6 cut(s)	188, 313, 337, 398, 549, 764
Hpy8I	GTNNAC	1 cut(s)	592
HpyCH4III	ACNGT	3 cut(s)	228, 611, 656
HpyCH4IV	ACGT	1 cut(s)	588
HpyCH4V	TGCA	5 cut(s)	159, 278, 585, 644, 706
HpyF10VI	GCNNNNNNNGC	4 cut(s)	105, 133, 147, 156
HpyF3I	CTNAG	2 cut(s)	350, 507
HpySE526I	ACGT	1 cut(s)	588
Hsp92II	CATG	6 cut(s)	51, 248, 380, 700, 735, 767
Ksp22I	TGATCA	2 cut(s)	408, 658
Kzo9I	GATC	5 cut(s)	238, 364, 394, 408, 658
Lsp1109I	GCAGC	3 cut(s)	22, 290, 333
LweI	GCATC	1 cut(s)	631
MaeII	ACGT	1 cut(s)	588
MaeIII	GTNAC	2 cut(s)	20, 370
MalI	GATC	5 cut(s)	240, 366, 396, 410, 660
MboI	GATC	5 cut(s)	238, 364, 394, 408, 658
MboII	GAAGA	4 cut(s)	208, 233, 480, 537
MlsI	TGGCCA	1 cut(s)	99
MluNI	TGGCCA	1 cut(s)	99
MlyI	GAGTC	2 cut(s)	156, 605
MmeI	TCCRAC	1 cut(s)	149
Mox20I	TGGCCA	1 cut(s)	99
Mph1103I	ATGCAT	1 cut(s)	646
MscI	TGGCCA	1 cut(s)	99
MseI	TTAA	4 cut(s)	36, 569, 800, 835
MslI	CAYNNNNRTG	1 cut(s)	701
Msp20I	TGGCCA	1 cut(s)	99
MspA1I	CMGCKG	2 cut(s)	144, 506
MspR9I	CCNGG	1 cut(s)	291
MvaI	CCWGG	1 cut(s)	291
MwoI	GCNNNNNNNGC	4 cut(s)	105, 133, 147, 156
NcoI	CCATGG	1 cut(s)	47
NdeII	GATC	5 cut(s)	238, 364, 394, 408, 658
NlaIII	CATG	6 cut(s)	51, 248, 380, 700, 735, 767
NmeAIII	GCCGAG	1 cut(s)	82
NmuCI	GTSAC	2 cut(s)	20, 370
NsiI	ATGCAT	1 cut(s)	646
PagI	TCATGA	1 cut(s)	763
PceI	AGGCCT	1 cut(s)	204
PfeI	GAWTC	2 cut(s)	215, 316
PkrI	GCNGC	4 cut(s)	12, 143, 280, 348
PleI	GAGTC	2 cut(s)	156, 604
PpsI	GAGTC	2 cut(s)	156, 604
Psp1406I	AACGTT	1 cut(s)	588
Psp6I	CCWGG	1 cut(s)	289
PspFI	CCCAGC	1 cut(s)	131
PspGI	CCWGG	1 cut(s)	289
PspPI	GGNCC	3 cut(s)	44, 171, 267
PstNI	CAGNNNCTG	1 cut(s)	218
PvuII	CAGCTG	1 cut(s)	506
RsaI	GTAC	1 cut(s)	666
RsaNI	GTAC	1 cut(s)	665
RseI	CAYNNNNRTG	1 cut(s)	701
SaqAI	TTAA	4 cut(s)	36, 569, 800, 835
SatI	GCNGC	4 cut(s)	11, 142, 279, 347
Sau3AI	GATC	5 cut(s)	238, 364, 394, 408, 658
Sau96I	GGNCC	3 cut(s)	44, 171, 267
SchI	GAGTC	2 cut(s)	156, 605
ScrFI	CCNGG	1 cut(s)	291
SetI	ASST	8 cut(s)	75, 129, 266, 348, 451, 508, 527, 591
SfaNI	GCATC	1 cut(s)	631
SinI	GGWCC	2 cut(s)	171, 267
SmiMI	CAYNNNNRTG	1 cut(s)	701
SseBI	AGGCCT	1 cut(s)	204
SsiI	CCGC	2 cut(s)	142, 632
StuI	AGGCCT	1 cut(s)	204
StyD4I	CCNGG	1 cut(s)	289
StyI	CCWWGG	1 cut(s)	47
TaaI	ACNGT	3 cut(s)	228, 611, 656
TaiI	ACGT	1 cut(s)	591
TaqI	TCGA	5 cut(s)	563, 639, 687, 789, 810
TauI	GCSGC	1 cut(s)	144
TfiI	GAWTC	2 cut(s)	215, 316
Tru1I	TTAA	4 cut(s)	36, 569, 800, 835
Tru9I	TTAA	4 cut(s)	36, 569, 800, 835
TscAI	CASTG	3 cut(s)	107, 326, 661
TseFI	GTSAC	2 cut(s)	20, 370
TseI	GCWGC	3 cut(s)	10, 278, 346
Tsp45I	GTSAC	2 cut(s)	20, 370
TspGWI	ACGGA	2 cut(s)	155, 173
TspRI	CASTG	3 cut(s)	107, 326, 661
VpaK11BI	GGWCC	2 cut(s)	171, 267
XapI	RAATTY	4 cut(s)	481, 511, 541, 831
Zsp2I	ATGCAT	1 cut(s)	646

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.