Rh7DG201400
MYB Family

Myb-like DNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0005146
Physical Location & Seq
Reverse (-)
19051953 .. 19054100
2148 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG201400.1

Sequence Viewer

Length: 483 bp
ATGGGAATTGATCCCGTCACGCATGAACCCCTCCACAAAGATCAAGATGACTTGATCAACAAGGAAACTATTATTTCATCCCATACTAATCAAGCTAACAATAACTTGCCTCAATCTACAACTGAAAACTCATCTTCAAACTCATCACCAGCTGAGAATTCATCATCAAGCTCATCACCAAATGAAAATTCTTCTGGAGACGACCAATCGACTTTAATTGATAGCATTTGCAACGTTGACGAGTCGTTGATGAACAGTCTTTGGGTGGATGAAACTCCGCTAATCGATGCATTGTGGAACAGTGATCAAGTACCAGATGGAGGAGATTACATCGAAAATGGCATGGGAGTGCAATCTAATTGGGAGGAGAATTGCTCATGGCTTTTGGACTGCCAAGACTTTGGCGTTCATGATTTCGGTATGGATTGCTTCATCGAAACCGAATTAAATGCCCTCGACACATTAGGGATGGAGAAAATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

160

Amino Acids

17.54

Weight (kDa)

4.05

Isoelectric Point (pI)

54.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 278
AclI AACGTT 1 cut(s) 234
AclWI GGATC 1 cut(s) 5
AcsI RAATTY 3 cut(s) 157, 187, 477
AfaI GTAC 1 cut(s) 312
AfiI CCNNNNNNNGG 1 cut(s) 320
AgsI TTSAA 1 cut(s) 138
AjuI GAANNNNNNNTTGG 2 cut(s) 172, 204
AluBI AGCT 3 cut(s) 95, 152, 171
AluI AGCT 3 cut(s) 95, 152, 171
Alw26I GTCTC 1 cut(s) 192
AlwI GGATC 1 cut(s) 5
ApoI RAATTY 3 cut(s) 157, 187, 477
AsuHPI GGTGA 2 cut(s) 138, 168
BccI CCATC 2 cut(s) 311, 463
BcgI CGANNNNNNTGC 2 cut(s) 431, 465
BclI TGATCA 2 cut(s) 54, 304
BcoDI GTCTC 1 cut(s) 192
BmsI GCATC 1 cut(s) 277
BplI GAGNNNNNCTC 2 cut(s) 359, 391
BpmI CTGGAG 1 cut(s) 216
Bsa29I ATCGAT 1 cut(s) 285
Bsc4I CCNNNNNNNGG 1 cut(s) 320
BseCI ATCGAT 1 cut(s) 285
BseGI GGATG 3 cut(s) 77, 274, 474
BseLI CCNNNNNNNGG 1 cut(s) 320
BseMII CTCAG 1 cut(s) 144
BseRI GAGGAG 2 cut(s) 336, 380
BshVI ATCGAT 1 cut(s) 285
BslI CCNNNNNNNGG 1 cut(s) 320
BsmAI GTCTC 1 cut(s) 192
BsmBI CGTCTC 1 cut(s) 192
Bsp143I GATC 4 cut(s) 10, 40, 54, 304
BspACI CCGC 1 cut(s) 278
BspCNI CTCAG 1 cut(s) 145
BspDI ATCGAT 1 cut(s) 285
BspHI TCATGA 1 cut(s) 409
BspPI GGATC 1 cut(s) 5
BssMI GATC 4 cut(s) 10, 40, 54, 304
Bst4CI ACNGT 2 cut(s) 257, 302
BstDEI CTNAG 1 cut(s) 153
BstF5I GGATG 3 cut(s) 77, 274, 474
BstKTI GATC 4 cut(s) 13, 43, 57, 307
BstMAI GTCTC 1 cut(s) 192
BstMBI GATC 4 cut(s) 10, 40, 54, 304
BstXI CCANNNNNNTGG 1 cut(s) 401
Bsu15I ATCGAT 1 cut(s) 285
BsuTUI ATCGAT 1 cut(s) 285
BtsCI GGATG 3 cut(s) 77, 274, 474
BtsIMutI CAGTG 1 cut(s) 307
CciI TCATGA 1 cut(s) 409
ClaI ATCGAT 1 cut(s) 285
Csp6I GTAC 1 cut(s) 311
CviAII CATG 4 cut(s) 23, 343, 378, 410
CviJI RGCY 4 cut(s) 95, 152, 171, 382
CviKI_1 RGCY 4 cut(s) 95, 152, 171, 382
CviQI GTAC 1 cut(s) 311
DdeI CTNAG 1 cut(s) 153
DpnI GATC 4 cut(s) 12, 42, 56, 306
DpnII GATC 4 cut(s) 10, 40, 54, 304
EcoRI GAATTC 1 cut(s) 157
EcoT22I ATGCAT 1 cut(s) 292
Esp3I CGTCTC 1 cut(s) 192
FaeI CATG 4 cut(s) 26, 346, 381, 413
FaiI YATR 6 cut(s) 24, 84, 344, 379, 411, 422
FatI CATG 4 cut(s) 22, 342, 377, 409
FbaI TGATCA 2 cut(s) 54, 304
FokI GGATG 2 cut(s) 64, 281
GsuI CTGGAG 1 cut(s) 216
Hin1II CATG 4 cut(s) 26, 346, 381, 413
HincII GTYRAC 1 cut(s) 238
HindII GTYRAC 1 cut(s) 238
HinfI GANTC 1 cut(s) 242
HphI GGTGA 2 cut(s) 138, 168
Hpy166II GTNNAC 1 cut(s) 238
Hpy188III TCNNGA 3 cut(s) 44, 195, 410
Hpy8I GTNNAC 1 cut(s) 238
HpyCH4III ACNGT 2 cut(s) 257, 302
HpyCH4IV ACGT 1 cut(s) 234
HpyCH4V TGCA 3 cut(s) 231, 290, 352
HpyF3I CTNAG 1 cut(s) 153
HpySE526I ACGT 1 cut(s) 234
Hsp92II CATG 4 cut(s) 26, 346, 381, 413
Ksp22I TGATCA 2 cut(s) 54, 304
Kzo9I GATC 4 cut(s) 10, 40, 54, 304
LpnPI CCDG 3 cut(s) 162, 180, 327
LweI GCATC 1 cut(s) 277
MaeII ACGT 1 cut(s) 234
MaeIII GTNAC 1 cut(s) 16
MalI GATC 4 cut(s) 12, 42, 56, 306
MboI GATC 4 cut(s) 10, 40, 54, 304
MboII GAAGA 2 cut(s) 126, 183
MluCI AATT 8 cut(s) 6, 157, 187, 216, 358, 370, 443, 477
MlyI GAGTC 1 cut(s) 251
MnlI CCTC 5 cut(s) 41, 120, 314, 358, 464
Mph1103I ATGCAT 1 cut(s) 292
MseI TTAA 3 cut(s) 215, 446, 481
MslI CAYNNNNRTG 1 cut(s) 347
MspA1I CMGCKG 1 cut(s) 152
NdeII GATC 4 cut(s) 10, 40, 54, 304
NlaIII CATG 4 cut(s) 26, 346, 381, 413
NmuCI GTSAC 1 cut(s) 16
NsiI ATGCAT 1 cut(s) 292
PagI TCATGA 1 cut(s) 409
PleI GAGTC 1 cut(s) 250
PpsI GAGTC 1 cut(s) 250
Psp1406I AACGTT 1 cut(s) 234
PvuII CAGCTG 1 cut(s) 152
RsaI GTAC 1 cut(s) 312
RsaNI GTAC 1 cut(s) 311
RseI CAYNNNNRTG 1 cut(s) 347
SaqAI TTAA 3 cut(s) 215, 446, 481
Sau3AI GATC 4 cut(s) 10, 40, 54, 304
SchI GAGTC 1 cut(s) 251
SetI ASST 4 cut(s) 97, 154, 173, 237
SfaNI GCATC 1 cut(s) 277
SmiMI CAYNNNNRTG 1 cut(s) 347
Sse9I AATT 8 cut(s) 6, 157, 187, 216, 358, 370, 443, 477
SsiI CCGC 1 cut(s) 278
TaaI ACNGT 2 cut(s) 257, 302
TaiI ACGT 1 cut(s) 237
TaqI TCGA 5 cut(s) 209, 285, 333, 435, 456
TasI AATT 8 cut(s) 6, 157, 187, 216, 358, 370, 443, 477
Tru1I TTAA 3 cut(s) 215, 446, 481
Tru9I TTAA 3 cut(s) 215, 446, 481
TscAI CASTG 1 cut(s) 307
TseFI GTSAC 1 cut(s) 16
Tsp45I GTSAC 1 cut(s) 16
TspDTI ATGAA 8 cut(s) 39, 66, 150, 198, 266, 285, 398, 421
TspRI CASTG 1 cut(s) 307
XapI RAATTY 3 cut(s) 157, 187, 477
Zsp2I ATGCAT 1 cut(s) 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.