Rmu_sc0007589.1_g000009

Cyclic nucleotide-gated ion channel 1-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007589.1
Physical Location & Seq
Reverse (-)
49150 .. 50085
936 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007589.1_g000009.1.cds

Sequence Viewer

Length: 816 bp
atgaaagcggaggcggagaaggaagctgaaaggataaggcatgaagctgatgaagctgatgaagctgaaaggataaggcaagagatacgtatatattcgtggatggaacgatttaattcgtatcggtttccgatggacgaagtcctgacaaaaatgaaagaaaagtggcaggagaacaaagaggttaatcttgatcatgtatcgactctattatctcttgtaccttcggagaggaatttagtctgcctgagcatgttagagaatctgccagtgtttaaagatatgaaacgggatgtgttgaccgaaattattgagttgatgaagatggtggagtactccgaaaatactttgattgttaaaaacgacggaccattggatcgcatgtttgtcattacagaagggactatgggggtccacacgactagcacggactcttctccatcagcaatcattaaagggtctcttgaggaatggaatgtctacggagttgagcaactactgagttgggcactctcaaccaacggaaatctcgactgccttcctatctcaaaagagaccgtcaagtgtcataccaaagtagaaggctttgttctcgaagcccgtgacttgaagaaggcgttctctaaatacggcgtaatccgagacaatgattctgatcaagatcatgaggaaatttctattgagaaggaaagttcttctagcaagagatcatcaatccttgcaccgataaaaaatacagcctctcgttttcggcgacgccttcaaggcataagattccgacccctctggctacagaggaatatgagaacgttgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

271

Amino Acids

31.49

Weight (kDa)

5.73

Isoelectric Point (pI)

50.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 480
AciI CCGC 2 cut(s) 8, 14
AclI AACGTT 1 cut(s) 809
AclWI GGATC 1 cut(s) 384
AcsI RAATTY 2 cut(s) 235, 672
AcyI GRCGYC 1 cut(s) 757
AfaI GTAC 2 cut(s) 222, 335
AgsI TTSAA 2 cut(s) 610, 764
AluBI AGCT 4 cut(s) 26, 47, 56, 65
AluI AGCT 4 cut(s) 26, 47, 56, 65
Alw26I GTCTC 3 cut(s) 465, 548, 636
AlwI GGATC 1 cut(s) 384
ApoI RAATTY 2 cut(s) 235, 672
Asp700I GAANNNNTTC 1 cut(s) 617
AspS9I GGNCC 2 cut(s) 368, 412
AvaII GGWCC 2 cut(s) 368, 412
BaeGI GKGCMC 1 cut(s) 511
BccI CCATC 4 cut(s) 97, 127, 319, 448
BceAI ACGGC 1 cut(s) 646
BclI TGATCA 2 cut(s) 193, 655
BcoDI GTCTC 3 cut(s) 465, 548, 636
BfaI CTAG 2 cut(s) 423, 699
BfmI CTRYAG 1 cut(s) 791
BglI GCCNNNNNGGC 1 cut(s) 765
BmcAI AGTACT 1 cut(s) 335
Bme18I GGWCC 2 cut(s) 368, 412
BmgT120I GGNCC 2 cut(s) 368, 412
BmiI GGNNCC 1 cut(s) 413
Bpu10I CCTNAGC 1 cut(s) 248
BpuEI CTTGAG 1 cut(s) 485
BsaAI YACGTR 1 cut(s) 89
BsaBI GATNNNNATC 2 cut(s) 654, 660
BsaHI GRCGYC 1 cut(s) 757
BsaI GGTCTC 2 cut(s) 465, 548
Bse1I ACTGG 1 cut(s) 269
Bse8I GATNNNNATC 2 cut(s) 654, 660
BseGI GGATG 2 cut(s) 108, 298
BseJI GATNNNNATC 2 cut(s) 654, 660
BseMII CTCAG 2 cut(s) 239, 491
BseNI ACTGG 1 cut(s) 269
BseSI GKGCMC 1 cut(s) 511
BslFI GGGAC 1 cut(s) 415
BsmAI GTCTC 3 cut(s) 465, 548, 636
BsmFI GGGAC 1 cut(s) 415
Bso31I GGTCTC 2 cut(s) 465, 548
Bsp1286I GDGCHC 1 cut(s) 511
Bsp143I GATC 5 cut(s) 193, 376, 655, 661, 707
BspACI CCGC 2 cut(s) 8, 14
BspCNI CTCAG 2 cut(s) 240, 492
BspHI TCATGA 1 cut(s) 664
BspLI GGNNCC 1 cut(s) 413
BspPI GGATC 1 cut(s) 384
BspTNI GGTCTC 2 cut(s) 465, 548
BsrI ACTGG 1 cut(s) 269
BssMI GATC 5 cut(s) 193, 376, 655, 661, 707
BssNI GRCGYC 1 cut(s) 757
Bst4CI ACNGT 1 cut(s) 559
Bst6I CTCTTC 1 cut(s) 439
BstACI GRCGYC 1 cut(s) 757
BstBAI YACGTR 1 cut(s) 89
BstDEI CTNAG 2 cut(s) 248, 500
BstF5I GGATG 2 cut(s) 108, 298
BstKTI GATC 5 cut(s) 196, 379, 658, 664, 710
BstMAI GTCTC 3 cut(s) 465, 548, 636
BstMBI GATC 5 cut(s) 193, 376, 655, 661, 707
BstMWI GCNNNNNNNGC 3 cut(s) 53, 62, 765
BstNSI RCATGY 2 cut(s) 256, 385
BstSFI CTRYAG 1 cut(s) 791
BstSLI GKGCMC 1 cut(s) 511
BstSNI TACGTA 1 cut(s) 89
BtsCI GGATG 2 cut(s) 108, 298
BtsIMutI CAGTG 1 cut(s) 276
CciI TCATGA 1 cut(s) 664
Cfr13I GGNCC 2 cut(s) 368, 412
CseI GACGC 1 cut(s) 765
Csp6I GTAC 2 cut(s) 221, 334
CviAII CATG 5 cut(s) 41, 197, 253, 382, 665
CviJI RGCY 8 cut(s) 26, 47, 56, 65, 585, 599, 740, 790
CviKI_1 RGCY 8 cut(s) 26, 47, 56, 65, 585, 599, 740, 790
CviQI GTAC 2 cut(s) 221, 334
DdeI CTNAG 2 cut(s) 248, 500
DpnI GATC 5 cut(s) 195, 378, 657, 663, 709
DpnII GATC 5 cut(s) 193, 376, 655, 661, 707
DraI TTTAAA 1 cut(s) 277
Eam1104I CTCTTC 1 cut(s) 439
EarI CTCTTC 1 cut(s) 439
EciI GGCGGA 1 cut(s) 29
Eco105I TACGTA 1 cut(s) 89
Eco31I GGTCTC 2 cut(s) 465, 548
Eco47I GGWCC 2 cut(s) 368, 412
FaeI CATG 5 cut(s) 44, 200, 256, 385, 668
FalI AAGNNNNNCTT 2 cut(s) 447, 479
FaqI GGGAC 1 cut(s) 415
FatI CATG 5 cut(s) 40, 196, 252, 381, 664
FbaI TGATCA 2 cut(s) 193, 655
FblI GTMKAC 1 cut(s) 480
FokI GGATG 2 cut(s) 115, 305
FspBI CTAG 2 cut(s) 423, 699
HgaI GACGC 1 cut(s) 765
Hin1I GRCGYC 1 cut(s) 757
Hin1II CATG 5 cut(s) 44, 200, 256, 385, 668
HincII GTYRAC 1 cut(s) 300
HindII GTYRAC 1 cut(s) 300
HinfI GANTC 5 cut(s) 205, 262, 431, 650, 774
Hpy166II GTNNAC 3 cut(s) 300, 415, 481
Hpy188I TCNGA 6 cut(s) 132, 229, 340, 641, 655, 779
Hpy188III TCNNGA 7 cut(s) 145, 191, 464, 530, 593, 659, 665
Hpy8I GTNNAC 3 cut(s) 300, 415, 481
Hpy99I CGWCG 2 cut(s) 368, 759
HpyAV CCTTC 8 cut(s) 13, 234, 392, 548, 575, 607, 679, 770
HpyCH4III ACNGT 1 cut(s) 559
HpyCH4IV ACGT 2 cut(s) 88, 809
HpyCH4V TGCA 1 cut(s) 722
HpyF10VI GCNNNNNNNGC 3 cut(s) 53, 62, 765
HpyF3I CTNAG 2 cut(s) 248, 500
HpySE526I ACGT 2 cut(s) 88, 809
Hsp92I GRCGYC 1 cut(s) 757
Hsp92II CATG 5 cut(s) 44, 200, 256, 385, 668
Ksp22I TGATCA 2 cut(s) 193, 655
Kzo9I GATC 5 cut(s) 193, 376, 655, 661, 707
LpnPI CCDG 5 cut(s) 155, 158, 260, 282, 772
MaeI CTAG 2 cut(s) 423, 699
MaeII ACGT 2 cut(s) 88, 809
MaeIII GTNAC 1 cut(s) 602
MalI GATC 5 cut(s) 195, 378, 657, 663, 709
MboI GATC 5 cut(s) 193, 376, 655, 661, 707
MboII GAAGA 4 cut(s) 334, 426, 622, 687
MhlI GDGCHC 1 cut(s) 511
MluCI AATT 4 cut(s) 115, 235, 306, 672
MlyI GAGTC 2 cut(s) 199, 425
MmeI TCCRAC 1 cut(s) 802
MnlI CCTC 8 cut(s) 4, 175, 225, 460, 661, 751, 789, 794
MroXI GAANNNNTTC 1 cut(s) 617
MseI TTAA 5 cut(s) 114, 186, 276, 357, 453
MwoI GCNNNNNNNGC 3 cut(s) 53, 62, 765
NdeII GATC 5 cut(s) 193, 376, 655, 661, 707
NlaIII CATG 5 cut(s) 44, 200, 256, 385, 668
NlaIV GGNNCC 1 cut(s) 413
NmuCI GTSAC 1 cut(s) 602
NspI RCATGY 2 cut(s) 256, 385
PagI TCATGA 1 cut(s) 664
PcsI WCGNNNNNNNCGW 2 cut(s) 528, 751
PdmI GAANNNNTTC 1 cut(s) 617
PfeI GAWTC 3 cut(s) 262, 650, 774
PflFI GACNNNGTC 1 cut(s) 140
PleI GAGTC 2 cut(s) 199, 425
PpsI GAGTC 2 cut(s) 199, 425
Ppu21I YACGTR 1 cut(s) 89
Psp1406I AACGTT 1 cut(s) 809
PspN4I GGNNCC 1 cut(s) 413
PspPI GGNCC 2 cut(s) 368, 412
PsyI GACNNNGTC 1 cut(s) 140
RsaI GTAC 2 cut(s) 222, 335
RsaNI GTAC 2 cut(s) 221, 334
SaqAI TTAA 5 cut(s) 114, 186, 276, 357, 453
Sau3AI GATC 5 cut(s) 193, 376, 655, 661, 707
Sau96I GGNCC 2 cut(s) 368, 412
ScaI AGTACT 1 cut(s) 335
SchI GAGTC 2 cut(s) 199, 425
SduI GDGCHC 1 cut(s) 511
SetI ASST 8 cut(s) 28, 49, 58, 67, 91, 186, 226, 812
SfcI CTRYAG 1 cut(s) 791
SinI GGWCC 2 cut(s) 368, 412
SmlI CTYRAG 1 cut(s) 464
SmoI CTYRAG 1 cut(s) 464
SnaBI TACGTA 1 cut(s) 89
Sse9I AATT 4 cut(s) 115, 235, 306, 672
SsiI CCGC 2 cut(s) 8, 14
SspMI CTAG 2 cut(s) 423, 699
TaaI ACNGT 1 cut(s) 559
TaiI ACGT 2 cut(s) 91, 812
TaqI TCGA 3 cut(s) 203, 531, 594
TaqII GACCGA 1 cut(s) 317
TasI AATT 4 cut(s) 115, 235, 306, 672
TatI WGTACW 1 cut(s) 333
TfiI GAWTC 3 cut(s) 262, 650, 774
Tru1I TTAA 5 cut(s) 114, 186, 276, 357, 453
Tru9I TTAA 5 cut(s) 114, 186, 276, 357, 453
TscAI CASTG 1 cut(s) 276
TseFI GTSAC 1 cut(s) 602
Tsp45I GTSAC 1 cut(s) 602
TspDTI ATGAA 7 cut(s) 17, 57, 66, 75, 170, 299, 335
TspGWI ACGGA 4 cut(s) 381, 443, 498, 537
TspRI CASTG 1 cut(s) 276
Tth111I GACNNNGTC 1 cut(s) 140
VpaK11BI GGWCC 2 cut(s) 368, 412
XapI RAATTY 2 cut(s) 235, 672
XceI RCATGY 2 cut(s) 256, 385
XmiI GTMKAC 1 cut(s) 480
XmnI GAANNNNTTC 1 cut(s) 617
XspI CTAG 2 cut(s) 423, 699
ZrmI AGTACT 1 cut(s) 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.