Rmu_sc0009005.1_g000013
MYB Family

SANT SWI3, ADA2, N-CoR and TFIIIB'' DNA-binding domains

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009005.1
Physical Location & Seq
Reverse (-)
57145 .. 57612
468 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009005.1_g000013.1.cds

Sequence Viewer

Length: 468 bp
atggaaggagaagatggtgctgcttctgatcatcttcaccatcatcacggtgtttatggcattcgaaacaatcacatacaaaatcctcatcagcatcacaaccaactcttcaagcctggtcctccgttgacagccatagacaggttcctgtggtctcaaaacaatgcaaagaacaaagagaggatcatctcctcaaatgggttttcctcatttggtggggcaatgggtgatctgcatgcttgttcgaattggccgccgagtagtctcggagagactagcttggatgaactgctttttcttgatcatggtgaggccatgacttggcctccagagaaaattcaaaaccctaacatggggttcaaagaagatcaagtgaaggtgggttctaaaggggtgggaaagagagctaaaacgggttcatctgtgcctttgatcaaaggacagtggacagatgaagaagacaggtaa

Protein Analysis

155

Amino Acids

17.17

Weight (kDa)

6.24

Isoelectric Point (pI)

24.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 321
AciI CCGC 1 cut(s) 254
AclWI GGATC 1 cut(s) 191
AcoI YGGCCR 1 cut(s) 251
AcsI RAATTY 1 cut(s) 336
AfiI CCNNNNNNNGG 5 cut(s) 141, 198, 321, 352, 353
AgsI TTSAA 3 cut(s) 112, 341, 361
AjnI CCWGG 1 cut(s) 115
AluBI AGCT 2 cut(s) 279, 407
AluI AGCT 2 cut(s) 279, 407
Alw26I GTCTC 3 cut(s) 159, 266, 269
AlwI GGATC 1 cut(s) 191
AoxI GGCC 3 cut(s) 251, 312, 323
ApeKI GCWGC 1 cut(s) 20
ApoI RAATTY 1 cut(s) 336
AspS9I GGNCC 1 cut(s) 119
AsuHPI GGTGA 3 cut(s) 29, 239, 320
AsuII TTCGAA 2 cut(s) 64, 245
AvaII GGWCC 1 cut(s) 119
BbvI GCAGC 1 cut(s) 7
BccI CCATC 2 cut(s) 8, 48
BciT130I CCWGG 1 cut(s) 117
BclI TGATCA 3 cut(s) 28, 301, 432
BcoDI GTCTC 3 cut(s) 159, 266, 269
BfaI CTAG 1 cut(s) 276
BisI GCNGC 2 cut(s) 21, 254
BlsI GCNGC 2 cut(s) 22, 255
Bme1390I CCNGG 1 cut(s) 117
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 119
BmiI GGNNCC 1 cut(s) 146
BmrFI CCNGG 1 cut(s) 117
BmsI GCATC 1 cut(s) 103
BpmI CTGGAG 1 cut(s) 312
Bpu14I TTCGAA 2 cut(s) 64, 245
BsaI GGTCTC 1 cut(s) 159
BsaXI ACNNNNNCTCC 2 cut(s) 310, 340
Bsc4I CCNNNNNNNGG 5 cut(s) 141, 198, 321, 352, 353
Bse3DI GCAATG 1 cut(s) 228
BseBI CCWGG 1 cut(s) 117
BseGI GGATG 1 cut(s) 289
BseLI CCNNNNNNNGG 5 cut(s) 141, 198, 321, 352, 353
BseMI GCAATG 1 cut(s) 228
BseRI GAGGAG 1 cut(s) 181
BseXI GCAGC 1 cut(s) 7
BshFI GGCC 3 cut(s) 253, 314, 325
BslI CCNNNNNNNGG 5 cut(s) 141, 198, 321, 352, 353
BsmAI GTCTC 3 cut(s) 159, 266, 269
BsmI GAATGC 1 cut(s) 60
BsnI GGCC 3 cut(s) 253, 314, 325
Bso31I GGTCTC 1 cut(s) 159
Bsp119I TTCGAA 2 cut(s) 64, 245
Bsp143I GATC 6 cut(s) 28, 183, 229, 301, 367, 432
BspACI CCGC 1 cut(s) 254
BspANI GGCC 3 cut(s) 253, 314, 325
BspLI GGNNCC 1 cut(s) 146
BspPI GGATC 1 cut(s) 191
BspT104I TTCGAA 2 cut(s) 64, 245
BspTNI GGTCTC 1 cut(s) 159
BsrDI GCAATG 1 cut(s) 228
BssMI GATC 6 cut(s) 28, 183, 229, 301, 367, 432
Bst2UI CCWGG 1 cut(s) 117
Bst4CI ACNGT 2 cut(s) 50, 444
Bst6I CTCTTC 1 cut(s) 113
BstBI TTCGAA 2 cut(s) 64, 245
BstC8I GCNNGC 1 cut(s) 237
BstF5I GGATG 1 cut(s) 289
BstKTI GATC 6 cut(s) 31, 186, 232, 304, 370, 435
BstMAI GTCTC 3 cut(s) 159, 266, 269
BstMBI GATC 6 cut(s) 28, 183, 229, 301, 367, 432
BstNI CCWGG 1 cut(s) 117
BstNSI RCATGY 1 cut(s) 239
BstSCI CCNGG 1 cut(s) 115
BstV1I GCAGC 1 cut(s) 7
BsuRI GGCC 3 cut(s) 253, 314, 325
BtsCI GGATG 1 cut(s) 289
BtsIMutI CAGTG 1 cut(s) 449
Cac8I GCNNGC 1 cut(s) 237
Cfr13I GGNCC 1 cut(s) 119
CviAII CATG 4 cut(s) 236, 305, 316, 352
CviJI RGCY 7 cut(s) 115, 134, 253, 279, 314, 325, 407
CviKI_1 RGCY 7 cut(s) 115, 134, 253, 279, 314, 325, 407
DpnI GATC 6 cut(s) 30, 185, 231, 303, 369, 434
DpnII GATC 6 cut(s) 28, 183, 229, 301, 367, 432
EaeI YGGCCR 1 cut(s) 251
Eam1104I CTCTTC 1 cut(s) 113
EarI CTCTTC 1 cut(s) 113
Eco31I GGTCTC 1 cut(s) 159
Eco47I GGWCC 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 115
FaeI CATG 4 cut(s) 239, 308, 319, 355
FaiI YATR 7 cut(s) 57, 77, 137, 237, 306, 317, 353
FatI CATG 4 cut(s) 235, 304, 315, 351
FbaI TGATCA 3 cut(s) 28, 301, 432
Fnu4HI GCNGC 2 cut(s) 21, 254
FokI GGATG 1 cut(s) 296
Fsp4HI GCNGC 2 cut(s) 21, 254
FspBI CTAG 1 cut(s) 276
GluI GCNGC 2 cut(s) 21, 254
GsuI CTGGAG 1 cut(s) 312
HaeIII GGCC 3 cut(s) 253, 314, 325
Hin1II CATG 4 cut(s) 239, 308, 319, 355
HincII GTYRAC 1 cut(s) 129
HindII GTYRAC 1 cut(s) 129
HphI GGTGA 3 cut(s) 29, 239, 320
Hpy166II GTNNAC 2 cut(s) 129, 447
Hpy188I TCNGA 2 cut(s) 28, 269
Hpy188III TCNNGA 2 cut(s) 299, 329
Hpy8I GTNNAC 2 cut(s) 129, 447
HpyAV CCTTC 1 cut(s) 370
HpyCH4III ACNGT 2 cut(s) 50, 444
HpyCH4V TGCA 2 cut(s) 167, 235
Hsp92II CATG 4 cut(s) 239, 308, 319, 355
Ksp22I TGATCA 3 cut(s) 28, 301, 432
Kzo9I GATC 6 cut(s) 28, 183, 229, 301, 367, 432
LpnPI CCDG 6 cut(s) 102, 127, 129, 161, 342, 448
Lsp1109I GCAGC 1 cut(s) 7
LweI GCATC 1 cut(s) 103
MaeI CTAG 1 cut(s) 276
MalI GATC 6 cut(s) 30, 185, 231, 303, 369, 434
MboI GATC 6 cut(s) 28, 183, 229, 301, 367, 432
MboII GAAGA 5 cut(s) 23, 26, 100, 377, 467
MluCI AATT 2 cut(s) 247, 336
MnlI CCTC 7 cut(s) 96, 132, 174, 202, 217, 304, 336
MslI CAYNNNNRTG 1 cut(s) 48
MspR9I CCNGG 1 cut(s) 117
Mva1269I GAATGC 1 cut(s) 60
MvaI CCWGG 1 cut(s) 117
NdeII GATC 6 cut(s) 28, 183, 229, 301, 367, 432
NlaIII CATG 4 cut(s) 239, 308, 319, 355
NlaIV GGNNCC 1 cut(s) 146
NmeAIII GCCGAG 1 cut(s) 282
NspI RCATGY 1 cut(s) 239
NspV TTCGAA 2 cut(s) 64, 245
PaeI GCATGC 1 cut(s) 239
PctI GAATGC 1 cut(s) 60
PflMI CCANNNNNTGG 1 cut(s) 321
PkrI GCNGC 2 cut(s) 22, 255
Psp6I CCWGG 1 cut(s) 115
PspGI CCWGG 1 cut(s) 115
PspN4I GGNNCC 1 cut(s) 146
PspPI GGNCC 1 cut(s) 119
RseI CAYNNNNRTG 1 cut(s) 48
SatI GCNGC 2 cut(s) 21, 254
Sau3AI GATC 6 cut(s) 28, 183, 229, 301, 367, 432
Sau96I GGNCC 1 cut(s) 119
ScrFI CCNGG 1 cut(s) 117
SetI ASST 5 cut(s) 146, 281, 381, 409, 467
SfaNI GCATC 1 cut(s) 103
SfuI TTCGAA 2 cut(s) 64, 245
SinI GGWCC 1 cut(s) 119
SmiMI CAYNNNNRTG 1 cut(s) 48
SphI GCATGC 1 cut(s) 239
Sse9I AATT 2 cut(s) 247, 336
SsiI CCGC 1 cut(s) 254
SspMI CTAG 1 cut(s) 276
StyD4I CCNGG 1 cut(s) 115
TaaI ACNGT 2 cut(s) 50, 444
TaqI TCGA 2 cut(s) 64, 245
TasI AATT 2 cut(s) 247, 336
TauI GCSGC 1 cut(s) 256
TscAI CASTG 1 cut(s) 449
TseI GCWGC 1 cut(s) 20
TspDTI ATGAA 3 cut(s) 300, 408, 468
TspGWI ACGGA 1 cut(s) 114
TspRI CASTG 1 cut(s) 449
Van91I CCANNNNNTGG 1 cut(s) 321
VpaK11BI GGWCC 1 cut(s) 119
XapI RAATTY 1 cut(s) 336
XceI RCATGY 1 cut(s) 239
XspI CTAG 1 cut(s) 276
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.