Rmu_sc0009816.1_g000005

Thylakoid lumenal 19 kDa protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009816.1
Physical Location & Seq
Reverse (-)
21456 .. 22214
759 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009816.1_g000005.1.cds

Sequence Viewer

Length: 615 bp
atggataccatgttctccatcaccaacaccaacaccccaaacaccaccatcccatctcccaaaccacctcaaactccaccaccgttcagaacccacctccccattccaccctccaagccactcctaactaccttaaccaccaccgctgcaactgctgccatcctaactaccactccaccctcattagcagactccccaacttaccaaatttactaccgcaccaccgccagcgctgccaactatggcggatacgatggcaactccgacaagaagacttcagccgatgaattctacaatccgaagaagaagatggagaaaaagtacatgtcttacctcggtgggttttggcaactagctacgaaggacgtggtgctgagcaatctagctctgtcagacatgaacttacaggacttgatagctagtgttgatgccattacgtcggaggagaagaaagacgagaagggacaggtttactatgtgtatgagataaatgaggttgcagcacatagtttgatatcaatgacttgtgctaacaacaagctttatgctcattttgtcaatgcgcctacccccgagtggaaccgcaacaatgatatgttgaagcatgttcattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

204

Amino Acids

22.66

Weight (kDa)

6.51

Isoelectric Point (pI)

35.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 5 cut(s) 144, 217, 225, 246, 583
AcsI RAATTY 2 cut(s) 207, 287
AcuI CTGAAG 1 cut(s) 261
AfaI GTAC 1 cut(s) 323
AfeI AGCGCT 1 cut(s) 232
AfiI CCNNNNNNNGG 1 cut(s) 576
AflIII ACRYGT 1 cut(s) 324
AgsI TTSAA 1 cut(s) 601
AjiI CACGTC 1 cut(s) 367
AloI GAACNNNNNNTCC 1 cut(s) 28
AluBI AGCT 4 cut(s) 356, 386, 419, 541
AluI AGCT 4 cut(s) 356, 386, 419, 541
Ama87I CYCGRG 1 cut(s) 572
Aor51HI AGCGCT 1 cut(s) 232
ApeKI GCWGC 4 cut(s) 146, 155, 233, 500
ApoI RAATTY 2 cut(s) 207, 287
AspLEI GCGC 2 cut(s) 233, 565
AsuHPI GGTGA 1 cut(s) 13
AvaI CYCGRG 1 cut(s) 572
BbsI GAAGAC 1 cut(s) 278
BbvI GCAGC 4 cut(s) 133, 142, 220, 512
BccI CCATC 6 cut(s) 26, 56, 61, 167, 248, 304
BciVI GTATCC 1 cut(s) 242
BfaI CTAG 3 cut(s) 353, 383, 420
BfoI RGCGCY 1 cut(s) 234
BfuI GTATCC 1 cut(s) 242
BisI GCNGC 4 cut(s) 147, 156, 234, 501
BlpI GCTNAGC 1 cut(s) 374
BlsI GCNGC 4 cut(s) 148, 157, 235, 502
BmeT110I CYCGRG 1 cut(s) 572
BmgBI CACGTC 1 cut(s) 367
BmiI GGNNCC 1 cut(s) 581
BmsI GCATC 1 cut(s) 418
BpiI GAAGAC 1 cut(s) 278
Bpu1102I GCTNAGC 1 cut(s) 374
BsaJI CCNNGG 1 cut(s) 334
BsaXI ACNNNNNCTCC 4 cut(s) 157, 187, 305, 335
Bsc4I CCNNNNNNNGG 1 cut(s) 576
BseDI CCNNGG 1 cut(s) 334
BseGI GGATG 2 cut(s) 48, 159
BseLI CCNNNNNNNGG 1 cut(s) 576
BseMII CTCAG 1 cut(s) 365
BseRI GAGGAG 1 cut(s) 458
BseXI GCAGC 4 cut(s) 133, 142, 220, 512
BsiHKCI CYCGRG 1 cut(s) 572
BslFI GGGAC 1 cut(s) 477
BslI CCNNNNNNNGG 1 cut(s) 576
BsmFI GGGAC 1 cut(s) 477
BsoBI CYCGRG 1 cut(s) 572
Bsp1720I GCTNAGC 1 cut(s) 374
BspACI CCGC 5 cut(s) 144, 217, 225, 246, 583
BspCNI CTCAG 1 cut(s) 366
BspLI GGNNCC 1 cut(s) 581
BssECI CCNNGG 1 cut(s) 334
Bst4CI ACNGT 1 cut(s) 84
BstAPI GCANNNNNTGC 1 cut(s) 155
BstC8I GCNNGC 1 cut(s) 229
BstDEI CTNAG 1 cut(s) 374
BstF5I GGATG 2 cut(s) 48, 159
BstH2I RGCGCY 1 cut(s) 234
BstHHI GCGC 2 cut(s) 233, 565
BstMWI GCNNNNNNNGC 3 cut(s) 152, 155, 233
BstNSI RCATGY 2 cut(s) 328, 608
BstV1I GCAGC 4 cut(s) 133, 142, 220, 512
BstV2I GAAGAC 1 cut(s) 278
BsuI GTATCC 1 cut(s) 242
BtrI CACGTC 1 cut(s) 367
BtsCI GGATG 2 cut(s) 48, 159
Cac8I GCNNGC 1 cut(s) 229
CfoI GCGC 2 cut(s) 233, 565
Csp6I GTAC 1 cut(s) 322
CviAII CATG 4 cut(s) 10, 325, 397, 605
CviJI RGCY 6 cut(s) 118, 281, 356, 386, 419, 541
CviKI_1 RGCY 6 cut(s) 118, 281, 356, 386, 419, 541
CviQI GTAC 1 cut(s) 322
DdeI CTNAG 1 cut(s) 374
EciI GGCGGA 1 cut(s) 261
Eco32I GATATC 1 cut(s) 516
Eco47III AGCGCT 1 cut(s) 232
Eco57I CTGAAG 1 cut(s) 261
Eco88I CYCGRG 1 cut(s) 572
EcoRI GAATTC 1 cut(s) 287
EcoRV GATATC 1 cut(s) 516
FaeI CATG 4 cut(s) 13, 328, 400, 608
FaqI GGGAC 1 cut(s) 477
FatI CATG 4 cut(s) 9, 324, 396, 604
Fnu4HI GCNGC 4 cut(s) 147, 156, 234, 501
FokI GGATG 2 cut(s) 35, 146
Fsp4HI GCNGC 4 cut(s) 147, 156, 234, 501
FspBI CTAG 3 cut(s) 353, 383, 420
GlaI GCGC 2 cut(s) 232, 564
GluI GCNGC 4 cut(s) 147, 156, 234, 501
HaeII RGCGCY 1 cut(s) 234
HhaI GCGC 2 cut(s) 233, 565
Hin1II CATG 4 cut(s) 13, 328, 400, 608
Hin6I GCGC 2 cut(s) 231, 563
HinP1I GCGC 2 cut(s) 231, 563
HindIII AAGCTT 1 cut(s) 539
HinfI GANTC 1 cut(s) 191
HphI GGTGA 1 cut(s) 13
Hpy166II GTNNAC 1 cut(s) 472
Hpy188I TCNGA 5 cut(s) 89, 265, 300, 394, 442
Hpy8I GTNNAC 1 cut(s) 472
Hpy99I CGWCG 1 cut(s) 442
HpyAV CCTTC 2 cut(s) 355, 454
HpyCH4III ACNGT 1 cut(s) 84
HpyCH4IV ACGT 2 cut(s) 366, 437
HpyCH4V TGCA 2 cut(s) 149, 500
HpyF10VI GCNNNNNNNGC 3 cut(s) 152, 155, 233
HpyF3I CTNAG 1 cut(s) 374
HpySE526I ACGT 2 cut(s) 366, 437
Hsp92II CATG 4 cut(s) 13, 328, 400, 608
HspAI GCGC 2 cut(s) 231, 563
LpnPI CCDG 3 cut(s) 241, 392, 452
Lsp1109I GCAGC 4 cut(s) 133, 142, 220, 512
LweI GCATC 1 cut(s) 418
MaeI CTAG 3 cut(s) 353, 383, 420
MaeII ACGT 2 cut(s) 366, 437
MboII GAAGA 5 cut(s) 283, 313, 316, 319, 460
MluCI AATT 2 cut(s) 207, 287
MlyI GAGTC 1 cut(s) 185
MmeI TCCRAC 2 cut(s) 288, 420
MnlI CCTC 7 cut(s) 78, 107, 121, 190, 344, 436, 487
MseI TTAA 1 cut(s) 134
MspA1I CMGCKG 1 cut(s) 146
MwoI GCNNNNNNNGC 3 cut(s) 152, 155, 233
NlaIII CATG 4 cut(s) 13, 328, 400, 608
NlaIV GGNNCC 1 cut(s) 581
NspI RCATGY 2 cut(s) 328, 608
PciI ACATGT 1 cut(s) 324
PkrI GCNGC 4 cut(s) 148, 157, 235, 502
PleI GAGTC 1 cut(s) 185
PpsI GAGTC 1 cut(s) 185
PscI ACATGT 1 cut(s) 324
PspN4I GGNNCC 1 cut(s) 581
RsaI GTAC 1 cut(s) 323
RsaNI GTAC 1 cut(s) 322
SaqAI TTAA 1 cut(s) 134
SatI GCNGC 4 cut(s) 147, 156, 234, 501
SchI GAGTC 1 cut(s) 185
SfaNI GCATC 1 cut(s) 418
Sse9I AATT 2 cut(s) 207, 287
SsiI CCGC 5 cut(s) 144, 217, 225, 246, 583
SspMI CTAG 3 cut(s) 353, 383, 420
TaaI ACNGT 1 cut(s) 84
TaiI ACGT 2 cut(s) 369, 440
TasI AATT 2 cut(s) 207, 287
TatI WGTACW 1 cut(s) 321
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TseI GCWGC 4 cut(s) 146, 155, 233, 500
TspDTI ATGAA 3 cut(s) 300, 413, 599
XapI RAATTY 2 cut(s) 207, 287
XceI RCATGY 2 cut(s) 328, 608
XspI CTAG 3 cut(s) 353, 383, 420
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.