Rmu_sc0010073.1_g000011

Belongs to the UDP-glycosyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010073.1
Physical Location & Seq
Forward (+)
56289 .. 56564
276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010073.1_g000011.1.cds

Sequence Viewer

Length: 276 bp
atgatcacatgccctctattcgctgagcaattccttaacgaaaaattgatcatagaggttttaaagatcggtgttcgggttggtgtggagattcctgctagatggggggatgaagagaaagttggagtgttggtgaagaaagatggggtgaagaaggcaatacgtttggaggtgaagaaggagaaaagagaagaaagagagcaacagaaattggagagaagggaagaagagccatcgaacaaggaggttcatcgcactcaagcatgtcttctttga

Protein Analysis

91

Amino Acids

10.64

Weight (kDa)

8.6

Isoelectric Point (pI)

61.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjuI GAANNNNNNNTTGG 2 cut(s) 105, 137
AsuHPI GGTGA 3 cut(s) 145, 160, 184
BbsI GAAGAC 1 cut(s) 260
BccI CCATC 3 cut(s) 96, 137, 241
BclI TGATCA 2 cut(s) 3, 48
BfaI CTAG 1 cut(s) 99
BlpI GCTNAGC 1 cut(s) 24
BpiI GAAGAC 1 cut(s) 260
Bpu1102I GCTNAGC 1 cut(s) 24
BpuEI CTTGAG 1 cut(s) 243
BsaXI ACNNNNNCTCC 2 cut(s) 117, 147
BseGI GGATG 1 cut(s) 115
BseMII CTCAG 1 cut(s) 15
Bsp143I GATC 3 cut(s) 3, 48, 66
Bsp1720I GCTNAGC 1 cut(s) 24
BspCNI CTCAG 1 cut(s) 16
BspQI GCTCTTC 1 cut(s) 222
BssMI GATC 3 cut(s) 3, 48, 66
Bst6I CTCTTC 2 cut(s) 108, 222
BstDEI CTNAG 1 cut(s) 24
BstF5I GGATG 1 cut(s) 115
BstKTI GATC 3 cut(s) 6, 51, 69
BstMBI GATC 3 cut(s) 3, 48, 66
BstNSI RCATGY 2 cut(s) 12, 267
BstV2I GAAGAC 1 cut(s) 260
BtgZI GCGATG 1 cut(s) 236
BtsCI GGATG 1 cut(s) 115
CviAII CATG 2 cut(s) 9, 264
CviJI RGCY 1 cut(s) 232
CviKI_1 RGCY 1 cut(s) 232
DdeI CTNAG 1 cut(s) 24
DpnI GATC 3 cut(s) 5, 50, 68
DpnII GATC 3 cut(s) 3, 48, 66
DraI TTTAAA 1 cut(s) 63
Eam1104I CTCTTC 2 cut(s) 108, 222
EarI CTCTTC 2 cut(s) 108, 222
FaeI CATG 2 cut(s) 12, 267
FaiI YATR 3 cut(s) 10, 53, 265
FalI AAGNNNNNCTT 1 cut(s) 252
FatI CATG 2 cut(s) 8, 263
FbaI TGATCA 2 cut(s) 3, 48
FokI GGATG 1 cut(s) 122
FspBI CTAG 1 cut(s) 99
Hin1II CATG 2 cut(s) 12, 267
HinfI GANTC 1 cut(s) 91
HphI GGTGA 3 cut(s) 145, 160, 184
HpyAV CCTTC 3 cut(s) 148, 172, 213
HpyCH4IV ACGT 1 cut(s) 163
HpyF3I CTNAG 1 cut(s) 24
HpySE526I ACGT 1 cut(s) 163
Hsp92II CATG 2 cut(s) 12, 267
Ksp22I TGATCA 2 cut(s) 3, 48
Kzo9I GATC 3 cut(s) 3, 48, 66
LguI GCTCTTC 1 cut(s) 222
LpnPI CCDG 1 cut(s) 108
MaeI CTAG 1 cut(s) 99
MaeII ACGT 1 cut(s) 163
MalI GATC 3 cut(s) 5, 50, 68
MboI GATC 3 cut(s) 3, 48, 66
MboII GAAGA 8 cut(s) 125, 148, 163, 187, 203, 236, 239, 260
MluCI AATT 3 cut(s) 29, 44, 209
MmeI TCCRAC 1 cut(s) 103
MnlI CCTC 4 cut(s) 24, 49, 163, 238
MseI TTAA 2 cut(s) 36, 62
NdeII GATC 3 cut(s) 3, 48, 66
NlaIII CATG 2 cut(s) 12, 267
NspI RCATGY 2 cut(s) 12, 267
PciSI GCTCTTC 1 cut(s) 222
PfeI GAWTC 1 cut(s) 91
SapI GCTCTTC 1 cut(s) 222
SaqAI TTAA 2 cut(s) 36, 62
Sau3AI GATC 3 cut(s) 3, 48, 66
SetI ASST 4 cut(s) 60, 166, 174, 249
SgeI CNNG 6 cut(s) 21, 89, 107, 111, 253, 272
SmlI CTYRAG 1 cut(s) 258
SmoI CTYRAG 1 cut(s) 258
Sse9I AATT 3 cut(s) 29, 44, 209
SspMI CTAG 1 cut(s) 99
TaiI ACGT 1 cut(s) 166
TaqI TCGA 1 cut(s) 236
TasI AATT 3 cut(s) 29, 44, 209
TfiI GAWTC 1 cut(s) 91
Tru1I TTAA 2 cut(s) 36, 62
Tru9I TTAA 2 cut(s) 36, 62
TspDTI ATGAA 2 cut(s) 126, 239
XceI RCATGY 2 cut(s) 12, 267
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.