Rh3BG190200

Belongs to the UDP-glycosyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
16823890 .. 16824120
231 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG190200.1

Sequence Viewer

Length: 231 bp
ATGGGGAGTGAGAGTCTTGACACCTTACTATCTCGAAATCTGCTGAGGAAGTTCTTTAAGGCTCTGAGCATGCTGCAAGAACCACTAGAAAAGTACCTTGAAGACCAGAAGCTTCAGCCATGGTGCATAATCTCGGACAAGGCCCTCTCGTGGACTTCAAAATTAAAACAGCTCAGAAGTTCAATATTCCAAGGATTGTTTTCCATGGAATGTGCTGCTTTTCACTGCTGA

Protein Analysis

76

Amino Acids

8.83

Weight (kDa)

8.53

Isoelectric Point (pI)

49.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 98
AfaI GTAC 1 cut(s) 95
AfiI CCNNNNNNNGG 1 cut(s) 150
AgsI TTSAA 3 cut(s) 101, 159, 183
AluBI AGCT 2 cut(s) 112, 172
AluI AGCT 2 cut(s) 112, 172
AoxI GGCC 1 cut(s) 141
ApeKI GCWGC 2 cut(s) 73, 215
AspS9I GGNCC 1 cut(s) 142
BauI CACGAG 1 cut(s) 148
BbsI GAAGAC 1 cut(s) 108
BbvCI CCTCAGC 1 cut(s) 44
BbvI GCAGC 2 cut(s) 60, 202
BfaI CTAG 1 cut(s) 86
BisI GCNGC 2 cut(s) 74, 216
BlsI GCNGC 2 cut(s) 75, 217
BmgT120I GGNCC 1 cut(s) 142
BpiI GAAGAC 1 cut(s) 108
Bpu10I CCTNAGC 1 cut(s) 44
BsaJI CCNNGG 3 cut(s) 119, 190, 204
BsaXI ACNNNNNCTCC 1 cut(s) 28
Bsc4I CCNNNNNNNGG 1 cut(s) 150
BseDI CCNNGG 3 cut(s) 119, 190, 204
BseLI CCNNNNNNNGG 1 cut(s) 150
BseMII CTCAG 3 cut(s) 35, 56, 187
BseXI GCAGC 2 cut(s) 60, 202
BshFI GGCC 1 cut(s) 143
BslI CCNNNNNNNGG 1 cut(s) 150
BsnI GGCC 1 cut(s) 143
Bsp19I CCATGG 2 cut(s) 119, 204
BspANI GGCC 1 cut(s) 143
BspCNI CTCAG 3 cut(s) 36, 57, 186
BssECI CCNNGG 3 cut(s) 119, 190, 204
BssSI CACGAG 1 cut(s) 148
BssT1I CCWWGG 3 cut(s) 119, 190, 204
Bst2BI CACGAG 1 cut(s) 148
BstC8I GCNNGC 1 cut(s) 71
BstDEI CTNAG 3 cut(s) 44, 65, 173
BstDSI CCRYGG 2 cut(s) 119, 204
BstNSI RCATGY 1 cut(s) 73
BstV1I GCAGC 2 cut(s) 60, 202
BstV2I GAAGAC 1 cut(s) 108
BsuRI GGCC 1 cut(s) 143
BtgI CCRYGG 2 cut(s) 119, 204
BtsI GCAGTG 1 cut(s) 223
BtsIMutI CAGTG 1 cut(s) 223
Cac8I GCNNGC 1 cut(s) 71
Cfr13I GGNCC 1 cut(s) 142
Csp6I GTAC 1 cut(s) 94
CviAII CATG 3 cut(s) 70, 120, 205
CviJI RGCY 5 cut(s) 62, 112, 118, 143, 172
CviKI_1 RGCY 5 cut(s) 62, 112, 118, 143, 172
CviQI GTAC 1 cut(s) 94
DdeI CTNAG 3 cut(s) 44, 65, 173
Eco130I CCWWGG 3 cut(s) 119, 190, 204
Eco57I CTGAAG 1 cut(s) 98
EcoO109I RGGNCCY 1 cut(s) 142
EcoT14I CCWWGG 3 cut(s) 119, 190, 204
ErhI CCWWGG 3 cut(s) 119, 190, 204
FaeI CATG 3 cut(s) 73, 123, 208
FaiI YATR 4 cut(s) 71, 121, 128, 206
FatI CATG 3 cut(s) 69, 119, 204
Fnu4HI GCNGC 2 cut(s) 74, 216
Fsp4HI GCNGC 2 cut(s) 74, 216
FspBI CTAG 1 cut(s) 86
GluI GCNGC 2 cut(s) 74, 216
HaeIII GGCC 1 cut(s) 143
Hin1II CATG 3 cut(s) 73, 123, 208
HindIII AAGCTT 1 cut(s) 110
HinfI GANTC 1 cut(s) 13
Hpy166II GTNNAC 1 cut(s) 153
Hpy188I TCNGA 3 cut(s) 66, 136, 176
Hpy188III TCNNGA 2 cut(s) 17, 33
Hpy8I GTNNAC 1 cut(s) 153
HpyCH4V TGCA 2 cut(s) 76, 126
HpyF3I CTNAG 3 cut(s) 44, 65, 173
Hsp92II CATG 3 cut(s) 73, 123, 208
LpnPI CCDG 1 cut(s) 119
Lsp1109I GCAGC 2 cut(s) 60, 202
MaeI CTAG 1 cut(s) 86
MboII GAAGA 1 cut(s) 113
MluCI AATT 1 cut(s) 161
MlyI GAGTC 1 cut(s) 22
MnlI CCTC 2 cut(s) 39, 155
MseI TTAA 2 cut(s) 57, 164
NcoI CCATGG 2 cut(s) 119, 204
NlaIII CATG 3 cut(s) 73, 123, 208
NspI RCATGY 1 cut(s) 73
PaeI GCATGC 1 cut(s) 73
PkrI GCNGC 2 cut(s) 75, 217
PleI GAGTC 1 cut(s) 21
PpsI GAGTC 1 cut(s) 21
PspPI GGNCC 1 cut(s) 142
RsaI GTAC 1 cut(s) 95
RsaNI GTAC 1 cut(s) 94
SaqAI TTAA 2 cut(s) 57, 164
SatI GCNGC 2 cut(s) 74, 216
Sau96I GGNCC 1 cut(s) 142
SchI GAGTC 1 cut(s) 22
SetI ASST 4 cut(s) 26, 99, 114, 174
SphI GCATGC 1 cut(s) 73
Sse9I AATT 1 cut(s) 161
SspI AATATT 1 cut(s) 186
SspMI CTAG 1 cut(s) 86
StyI CCWWGG 3 cut(s) 119, 190, 204
TaqI TCGA 1 cut(s) 34
TasI AATT 1 cut(s) 161
Tru1I TTAA 2 cut(s) 57, 164
Tru9I TTAA 2 cut(s) 57, 164
TscAI CASTG 1 cut(s) 230
TseI GCWGC 2 cut(s) 73, 215
TspRI CASTG 1 cut(s) 230
XceI RCATGY 1 cut(s) 73
XspI CTAG 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.