Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011761.1

Orthogroup ID

OG0001629

Physical Location & Seq

Genomic Coordinates Reverse (-)

25212 .. 27042

Gene Structure 1831 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011761.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 954 bp

atggtgacagaacttcgaacagattctttggattaccgcacagagctgttgtcgccggacctgacaagagagactgtgacactgccaagtgagccggcgtggcggctcaatatggatggcttcaagcttccagctgagagaaacaacatggatcctttttttggctttggctcttttgttcagtcattacggacgaaaagaaaggttgcacagtattacaggaggcagaacaaacttctcaaaggtttcaatgaattagactcattttctgaaatgggtttttggcctggaagtttaacaaagaatatcatcctttcagtaatggcaactcttggattgcaaattttgtttgaatcaggccgacaacttgtcatgaagactcaacctgataaggacccagagaaagagaaatggatgatagggataatggtctctgtcacaatagtcaagattgttctaatggtatactgtcgaagattcaaaaacgaaattgttcgagcatatgctcaagatcatctatttgatgtcatcactaatgcaattggtcttgcatcagcagtgttagccgtcaggttttactggtggatcgatccaattggagctatcatcattgctttgtatacaatggcgaactgggcaaaaacagtgatggacaatgtgtggtcactaattgggaagacagcaccggcagagtacttggccaagttaacatatctaatttggaaccacgacaaggagatcaagcacattgagacagtgagagcatacacatttggtgttaactattttgtagaggttcatatagtcttacctggggacatgtctctcagtgatgcacataatatcggagaggcactccaagaaaagcttgagaatcttcctgaggttgaacgagcttttgttcatgttgatgttgacattactcacaagccagagcacaagccaaagggatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cation_efflux ZT_dimer

Protein Analysis

317

Amino Acids

36.45

Weight (kDa)

6.72

Isoelectric Point (pI)

41.76

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001629)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G39450
fragaria_vesca	FvH4_3g14571 FvH4_3g14571 FvH4_7g21220 FvH4_7g21220
malus_domestica	MD01G1120600.v1.1 MD05G1235000.v1.1 MD07G1190000.v1.1
prunus_persica	Prupe.2G227500_v2.0.a1 Prupe.2G227500_v2.0.a1 Prupe.2G227500_v2.0.a1 Prupe.2G227500_v2.0.a1 Prupe.2G227500_v2.0.a1 Prupe.4G131200_v2.0.a1
pyrus_communis	pycom01g14720 pycom05g21190 pycom07g17960
rosa_chinensis	RchiOBHm_Chr1g0365671 RchiOBHm_Chr5g0024031 RchiOBHm_Chr5g0024041
rosa_laevigata	RLG00000032756
rosa_multiflora	Rmu_co8495291.1_g000001 Rmu_sc0002093.1_g000006 Rmu_sc0011761.1_g000003 Rmu_sc0011761.1_g000004 Rmu_sc0023483.1_g000001
rosa_roxburghii	Rroxscaffold_1G00055200 Rroxscaffold_1G00055210 Rroxscaffold_4G00291100
rosa_rugosa	Rorug01G0322400 Rorug01G0322500 Rorug05G0081100 Rorug05G0081100 Rorug05G0081200
rosa_samantha	Rh1AG331200 Rh1BG292600 Rh1CG309200 Rh1DG324200 Rh5AG171400 Rh5AG171500 Rh5BG168100 Rh5BG168200 Rh5CG183600 Rh5CG183700 Rh5DG170200 Rh5DG170300
rosa_wichuraiana	Rw1G029420 Rw5G015510 Rw5G015520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	465, 620
AciI	CCGC	2 cut(s)	37, 103
AclWI	GGATC	4 cut(s)	146, 159, 584, 593
AcoI	YGGCCR	1 cut(s)	699
AcsI	RAATTY	1 cut(s)	342
AfaI	GTAC	1 cut(s)	695
AfiI	CCNNNNNNNGG	2 cut(s)	161, 733
AflIII	ACRYGT	1 cut(s)	819
AgsI	TTSAA	5 cut(s)	124, 250, 353, 481, 890
AhdI	GACNNNNNGTC	1 cut(s)	368
AjnI	CCWGG	2 cut(s)	286, 811
AluBI	AGCT	6 cut(s)	46, 127, 134, 602, 868, 896
AluI	AGCT	6 cut(s)	46, 127, 134, 602, 868, 896
Alw21I	GWGCWC	1 cut(s)	939
Alw26I	GTCTC	4 cut(s)	65, 436, 746, 828
AlwI	GGATC	4 cut(s)	146, 159, 584, 593
AoxI	GGCC	3 cut(s)	284, 358, 699
ApoI	RAATTY	1 cut(s)	342
Asp700I	GAANNNNTTC	2 cut(s)	22, 492
AspS9I	GGNCC	2 cut(s)	58, 394
AsuHPI	GGTGA	1 cut(s)	16
AsuII	TTCGAA	1 cut(s)	16
AvaII	GGWCC	2 cut(s)	58, 394
AxyI	CCTNAGG	1 cut(s)	882
BalI	TGGCCA	1 cut(s)	701
BamHI	GGATCC	1 cut(s)	151
BbsI	GAAGAC	2 cut(s)	383, 683
Bbv12I	GWGCWC	1 cut(s)	939
BccI	CCATC	2 cut(s)	110, 643
BceAI	ACGGC	1 cut(s)	551
BciT130I	CCWGG	2 cut(s)	288, 813
BcoDI	GTCTC	4 cut(s)	65, 436, 746, 828
BglI	GCCNNNNNGGC	1 cut(s)	100
BisI	GCNGC	1 cut(s)	104
BlsI	GCNGC	1 cut(s)	105
BmcAI	AGTACT	1 cut(s)	695
Bme1390I	CCNGG	2 cut(s)	288, 813
Bme18I	GGWCC	2 cut(s)	58, 394
BmeRI	GACNNNNNGTC	1 cut(s)	368
BmgT120I	GGNCC	2 cut(s)	58, 394
BmiI	GGNNCC	3 cut(s)	153, 396, 725
BmrFI	CCNGG	2 cut(s)	288, 813
BmrI	ACTGGG	1 cut(s)	643
BmsI	GCATC	2 cut(s)	560, 823
BmuI	ACTGGG	1 cut(s)	643
BpiI	GAAGAC	2 cut(s)	383, 683
BplI	GAGNNNNNCTC	2 cut(s)	840, 872
Bpu14I	TTCGAA	1 cut(s)	16
BpuEI	CTTGAG	2 cut(s)	492, 890
Bsa29I	ATCGAT	1 cut(s)	588
BsaI	GGTCTC	1 cut(s)	436
BsaJI	CCNNGG	1 cut(s)	812
Bsc4I	CCNNNNNNNGG	2 cut(s)	161, 733
Bse118I	RCCGGY	2 cut(s)	94, 685
Bse1I	ACTGG	2 cut(s)	584, 638
Bse21I	CCTNAGG	1 cut(s)	882
Bse3DI	GCAATG	1 cut(s)	609
BseBI	CCWGG	2 cut(s)	288, 813
BseCI	ATCGAT	1 cut(s)	588
BseDI	CCNNGG	1 cut(s)	812
BseGI	GGATG	3 cut(s)	121, 309, 420
BseLI	CCNNNNNNNGG	2 cut(s)	161, 733
BseMI	GCAATG	1 cut(s)	609
BseMII	CTCAG	3 cut(s)	126, 841, 873
BseNI	ACTGG	2 cut(s)	584, 638
BshFI	GGCC	3 cut(s)	286, 360, 701
BshVI	ATCGAT	1 cut(s)	588
BsiHKAI	GWGCWC	1 cut(s)	939
BsiSI	CCGG	3 cut(s)	56, 95, 686
BslFI	GGGAC	1 cut(s)	830
BslI	CCNNNNNNNGG	2 cut(s)	161, 733
BsmAI	GTCTC	4 cut(s)	65, 436, 746, 828
BsmFI	GGGAC	1 cut(s)	830
BsnI	GGCC	3 cut(s)	286, 360, 701
Bso31I	GGTCTC	1 cut(s)	436
Bsp119I	TTCGAA	1 cut(s)	16
Bsp1286I	GDGCHC	1 cut(s)	939
Bsp143I	GATC	5 cut(s)	151, 511, 585, 589, 738
BspACI	CCGC	2 cut(s)	37, 103
BspANI	GGCC	3 cut(s)	286, 360, 701
BspCNI	CTCAG	3 cut(s)	127, 840, 874
BspDI	ATCGAT	1 cut(s)	588
BspHI	TCATGA	1 cut(s)	372
BspLI	GGNNCC	3 cut(s)	153, 396, 725
BspPI	GGATC	4 cut(s)	146, 159, 584, 593
BspT104I	TTCGAA	1 cut(s)	16
BspTNI	GGTCTC	1 cut(s)	436
BsrDI	GCAATG	1 cut(s)	609
BsrFI	RCCGGY	2 cut(s)	94, 685
BsrI	ACTGG	2 cut(s)	584, 638
BssAI	RCCGGY	2 cut(s)	94, 685
BssECI	CCNNGG	1 cut(s)	812
BssMI	GATC	5 cut(s)	151, 511, 585, 589, 738
BssNAI	GTATAC	2 cut(s)	466, 621
Bst1107I	GTATAC	2 cut(s)	466, 621
Bst2UI	CCWGG	2 cut(s)	288, 813
Bst4CI	ACNGT	5 cut(s)	76, 213, 470, 646, 757
BstBI	TTCGAA	1 cut(s)	16
BstC8I	GCNNGC	1 cut(s)	96
BstDEI	CTNAG	3 cut(s)	135, 827, 882
BstF5I	GGATG	3 cut(s)	121, 309, 420
BstKTI	GATC	5 cut(s)	154, 514, 588, 592, 741
BstMAI	GTCTC	4 cut(s)	65, 436, 746, 828
BstMBI	GATC	5 cut(s)	151, 511, 585, 589, 738
BstMWI	GCNNNNNNNGC	5 cut(s)	52, 91, 100, 563, 635
BstNI	CCWGG	2 cut(s)	288, 813
BstNSI	RCATGY	1 cut(s)	823
BstSCI	CCNGG	2 cut(s)	286, 811
BstV2I	GAAGAC	2 cut(s)	383, 683
BstX2I	RGATCY	1 cut(s)	151
BstYI	RGATCY	1 cut(s)	151
BstZ17I	GTATAC	2 cut(s)	466, 621
Bsu15I	ATCGAT	1 cut(s)	588
Bsu36I	CCTNAGG	1 cut(s)	882
BsuRI	GGCC	3 cut(s)	286, 360, 701
BsuTUI	ATCGAT	1 cut(s)	588
BtsCI	GGATG	3 cut(s)	121, 309, 420
BtsI	GCAGTG	2 cut(s)	80, 564
BtsIMutI	CAGTG	5 cut(s)	80, 564, 651, 762, 835
Cac8I	GCNNGC	1 cut(s)	96
CciI	TCATGA	1 cut(s)	372
Cfr10I	RCCGGY	2 cut(s)	94, 685
Cfr13I	GGNCC	2 cut(s)	58, 394
ClaI	ATCGAT	1 cut(s)	588
Csp6I	GTAC	1 cut(s)	694
CviAII	CATG	4 cut(s)	148, 373, 820, 905
CviQI	GTAC	1 cut(s)	694
DdeI	CTNAG	3 cut(s)	135, 827, 882
DpnI	GATC	5 cut(s)	153, 513, 587, 591, 740
DpnII	GATC	5 cut(s)	151, 511, 585, 589, 738
DriI	GACNNNNNGTC	1 cut(s)	368
EaeI	YGGCCR	1 cut(s)	699
Eam1105I	GACNNNNNGTC	1 cut(s)	368
Eco31I	GGTCTC	1 cut(s)	436
Eco47I	GGWCC	2 cut(s)	58, 394
Eco81I	CCTNAGG	1 cut(s)	882
EcoO109I	RGGNCCY	1 cut(s)	394
EcoRII	CCWGG	2 cut(s)	286, 811
FaeI	CATG	4 cut(s)	151, 376, 823, 908
FalI	AAGNNNNNCTT	2 cut(s)	852, 884
FaqI	GGGAC	1 cut(s)	830
FatI	CATG	4 cut(s)	147, 372, 819, 904
FauNDI	CATATG	1 cut(s)	502
FblI	GTMKAC	2 cut(s)	465, 620
Fnu4HI	GCNGC	1 cut(s)	104
FokI	GGATG	3 cut(s)	128, 296, 427
Fsp4HI	GCNGC	1 cut(s)	104
GluI	GCNGC	1 cut(s)	104
HaeIII	GGCC	3 cut(s)	286, 360, 701
HapII	CCGG	3 cut(s)	56, 95, 686
Hin1II	CATG	4 cut(s)	151, 376, 823, 908
HincII	GTYRAC	3 cut(s)	708, 781, 916
HindII	GTYRAC	3 cut(s)	708, 781, 916
HindIII	AAGCTT	2 cut(s)	125, 866
HinfI	GANTC	6 cut(s)	23, 260, 353, 379, 477, 874
HpaI	GTTAAC	2 cut(s)	708, 781
HpaII	CCGG	3 cut(s)	56, 95, 686
HphI	GGTGA	1 cut(s)	16
Hpy166II	GTNNAC	5 cut(s)	466, 621, 708, 781, 916
Hpy188I	TCNGA	2 cut(s)	271, 848
Hpy188III	TCNNGA	4 cut(s)	373, 448, 509, 881
Hpy8I	GTNNAC	5 cut(s)	466, 621, 708, 781, 916
HpyCH4III	ACNGT	5 cut(s)	76, 213, 470, 646, 757
HpyCH4V	TGCA	5 cut(s)	209, 340, 539, 551, 836
HpyF10VI	GCNNNNNNNGC	5 cut(s)	52, 91, 100, 563, 635
HpyF3I	CTNAG	3 cut(s)	135, 827, 882
Hsp92II	CATG	4 cut(s)	151, 376, 823, 908
KroI	GCCGGC	1 cut(s)	94
KroNI	GCCGGC	1 cut(s)	96
KspAI	GTTAAC	2 cut(s)	708, 781
Kzo9I	GATC	5 cut(s)	151, 511, 585, 589, 738
LmnI	GCTCC	1 cut(s)	599
LweI	GCATC	2 cut(s)	560, 823
MaeIII	GTNAC	4 cut(s)	4, 76, 436, 663
MalI	GATC	5 cut(s)	153, 513, 587, 591, 740
MboI	GATC	5 cut(s)	151, 511, 585, 589, 738
MboII	GAAGA	4 cut(s)	388, 486, 688, 869
MfeI	CAATTG	2 cut(s)	540, 594
MflI	RGATCY	1 cut(s)	151
MhlI	GDGCHC	1 cut(s)	939
MlsI	TGGCCA	1 cut(s)	701
MluCI	AATT	7 cut(s)	254, 342, 489, 540, 594, 669, 717
MluNI	TGGCCA	1 cut(s)	701
MlyI	GAGTC	2 cut(s)	254, 373
MnlI	CCTC	4 cut(s)	216, 787, 844, 877
Mox20I	TGGCCA	1 cut(s)	701
MroNI	GCCGGC	1 cut(s)	94
MroXI	GAANNNNTTC	2 cut(s)	22, 492
MscI	TGGCCA	1 cut(s)	701
MseI	TTAA	3 cut(s)	296, 707, 780
MslI	CAYNNNNRTG	1 cut(s)	909
Msp20I	TGGCCA	1 cut(s)	701
MspA1I	CMGCKG	1 cut(s)	134
MspI	CCGG	3 cut(s)	56, 95, 686
MspR9I	CCNGG	2 cut(s)	288, 813
MunI	CAATTG	2 cut(s)	540, 594
MvaI	CCWGG	2 cut(s)	288, 813
MwoI	GCNNNNNNNGC	5 cut(s)	52, 91, 100, 563, 635
NaeI	GCCGGC	1 cut(s)	96
NdeI	CATATG	1 cut(s)	502
NdeII	GATC	5 cut(s)	151, 511, 585, 589, 738
NgoMIV	GCCGGC	1 cut(s)	94
NlaIII	CATG	4 cut(s)	151, 376, 823, 908
NlaIV	GGNNCC	3 cut(s)	153, 396, 725
NmuCI	GTSAC	4 cut(s)	4, 76, 436, 663
NspI	RCATGY	1 cut(s)	823
NspV	TTCGAA	1 cut(s)	16
PagI	TCATGA	1 cut(s)	372
PciI	ACATGT	1 cut(s)	819
PdiI	GCCGGC	1 cut(s)	96
PdmI	GAANNNNTTC	2 cut(s)	22, 492
PfeI	GAWTC	4 cut(s)	23, 353, 477, 874
PkrI	GCNGC	1 cut(s)	105
PleI	GAGTC	2 cut(s)	254, 373
PpsI	GAGTC	2 cut(s)	254, 373
PpuMI	RGGWCCY	1 cut(s)	394
PscI	ACATGT	1 cut(s)	819
Psp5II	RGGWCCY	1 cut(s)	394
Psp6I	CCWGG	2 cut(s)	286, 811
PspGI	CCWGG	2 cut(s)	286, 811
PspN4I	GGNNCC	3 cut(s)	153, 396, 725
PspPI	GGNCC	2 cut(s)	58, 394
PspPPI	RGGWCCY	1 cut(s)	394
PsuI	RGATCY	1 cut(s)	151
PvuII	CAGCTG	1 cut(s)	134
RsaI	GTAC	1 cut(s)	695
RsaNI	GTAC	1 cut(s)	694
RseI	CAYNNNNRTG	1 cut(s)	909
SaqAI	TTAA	3 cut(s)	296, 707, 780
SatI	GCNGC	1 cut(s)	104
Sau3AI	GATC	5 cut(s)	151, 511, 585, 589, 738
Sau96I	GGNCC	2 cut(s)	58, 394
ScaI	AGTACT	1 cut(s)	695
SchI	GAGTC	2 cut(s)	254, 373
ScrFI	CCNGG	2 cut(s)	288, 813
SduI	GDGCHC	1 cut(s)	939
SfaNI	GCATC	2 cut(s)	560, 823
SfuI	TTCGAA	1 cut(s)	16
SinI	GGWCC	2 cut(s)	58, 394
SmiMI	CAYNNNNRTG	1 cut(s)	909
SmlI	CTYRAG	2 cut(s)	507, 869
SmoI	CTYRAG	2 cut(s)	507, 869
Sse9I	AATT	7 cut(s)	254, 342, 489, 540, 594, 669, 717
SsiI	CCGC	2 cut(s)	37, 103
StyD4I	CCNGG	2 cut(s)	286, 811
TaaI	ACNGT	5 cut(s)	76, 213, 470, 646, 757
TaqI	TCGA	4 cut(s)	16, 472, 496, 588
TasI	AATT	7 cut(s)	254, 342, 489, 540, 594, 669, 717
TatI	WGTACW	1 cut(s)	693
TauI	GCSGC	1 cut(s)	106
TfiI	GAWTC	4 cut(s)	23, 353, 477, 874
Tru1I	TTAA	3 cut(s)	296, 707, 780
Tru9I	TTAA	3 cut(s)	296, 707, 780
TscAI	CASTG	5 cut(s)	87, 564, 651, 762, 835
TseFI	GTSAC	4 cut(s)	4, 76, 436, 663
Tsp45I	GTSAC	4 cut(s)	4, 76, 436, 663
TspDTI	ATGAA	4 cut(s)	267, 389, 788, 893
TspGWI	ACGGA	1 cut(s)	205
TspRI	CASTG	5 cut(s)	87, 564, 651, 762, 835
VpaK11BI	GGWCC	2 cut(s)	58, 394
XapI	RAATTY	1 cut(s)	342
XceI	RCATGY	1 cut(s)	823
XmiI	GTMKAC	2 cut(s)	465, 620
XmnI	GAANNNNTTC	2 cut(s)	22, 492
ZrmI	AGTACT	1 cut(s)	695

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.