Rmu_sc0014584.1_g000001
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014584.1
Physical Location & Seq
Forward (+)
43 .. 556
514 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014584.1_g000001.1.cds

Sequence Viewer

Length: 330 bp
atgtgtggaactctggattatttagccccagaactggtggagaataaagctcatgactacacagtcgataactggactttgggcattctttgctatgagtttctctttggcgttcctccctttgaggctgaaagtcaaaaagatacatttcaaaggatagtgaaggttgacctgagcttccctgcaacacctcaagtttctgctgaagccaaagatctcattaccaagcttctcgtgaaggacatctcaaagaggctctctcttcagaagatcatggaacacccatggatagttaagaatgcagatcctactggtatctgcaataactag

Protein Analysis

109

Amino Acids

12.33

Weight (kDa)

5.04

Isoelectric Point (pI)

19.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 62
AclWI GGATC 1 cut(s) 299
AcuI CTGAAG 2 cut(s) 225, 248
AfiI CCNNNNNNNGG 1 cut(s) 34
AgsI TTSAA 1 cut(s) 152
AluBI AGCT 3 cut(s) 50, 177, 229
AluI AGCT 3 cut(s) 50, 177, 229
AlwI GGATC 1 cut(s) 299
BauI CACGAG 1 cut(s) 233
BfaI CTAG 1 cut(s) 328
BglII AGATCT 1 cut(s) 214
BplI GAGNNNNNCTC 2 cut(s) 244, 276
Bpu10I CCTNAGC 1 cut(s) 173
BpuEI CTTGAG 1 cut(s) 177
BsaJI CCNNGG 1 cut(s) 284
Bsc4I CCNNNNNNNGG 1 cut(s) 34
Bse1I ACTGG 3 cut(s) 39, 77, 316
BseDI CCNNGG 1 cut(s) 284
BseLI CCNNNNNNNGG 1 cut(s) 34
BseMII CTCAG 1 cut(s) 164
BseNI ACTGG 3 cut(s) 39, 77, 316
BslI CCNNNNNNNGG 1 cut(s) 34
BsmI GAATGC 2 cut(s) 84, 304
Bsp143I GATC 3 cut(s) 214, 270, 304
Bsp19I CCATGG 1 cut(s) 284
BspCNI CTCAG 1 cut(s) 165
BspHI TCATGA 1 cut(s) 52
BspPI GGATC 1 cut(s) 299
BsrI ACTGG 3 cut(s) 39, 77, 316
BssECI CCNNGG 1 cut(s) 284
BssMI GATC 3 cut(s) 214, 270, 304
BssSI CACGAG 1 cut(s) 233
BssT1I CCWWGG 1 cut(s) 284
Bst2BI CACGAG 1 cut(s) 233
Bst4CI ACNGT 1 cut(s) 64
Bst6I CTCTTC 1 cut(s) 267
BstAPI GCANNNNNTGC 1 cut(s) 90
BstDEI CTNAG 1 cut(s) 173
BstDSI CCRYGG 1 cut(s) 284
BstKTI GATC 3 cut(s) 217, 273, 307
BstMBI GATC 3 cut(s) 214, 270, 304
BstMWI GCNNNNNNNGC 1 cut(s) 90
BstX2I RGATCY 2 cut(s) 214, 304
BstYI RGATCY 2 cut(s) 214, 304
BtgI CCRYGG 1 cut(s) 284
CciI TCATGA 1 cut(s) 52
CviAII CATG 3 cut(s) 53, 274, 285
CviJI RGCY 7 cut(s) 26, 50, 128, 177, 209, 229, 256
CviKI_1 RGCY 7 cut(s) 26, 50, 128, 177, 209, 229, 256
DdeI CTNAG 1 cut(s) 173
DpnI GATC 3 cut(s) 216, 272, 306
DpnII GATC 3 cut(s) 214, 270, 304
DrdI GACNNNNNNGTC 1 cut(s) 62
DseDI GACNNNNNNGTC 1 cut(s) 62
Eam1104I CTCTTC 1 cut(s) 267
EarI CTCTTC 1 cut(s) 267
Eco130I CCWWGG 1 cut(s) 284
Eco57I CTGAAG 2 cut(s) 225, 248
EcoT14I CCWWGG 1 cut(s) 284
ErhI CCWWGG 1 cut(s) 284
FaeI CATG 3 cut(s) 56, 277, 288
FaiI YATR 4 cut(s) 54, 96, 275, 286
FatI CATG 3 cut(s) 52, 273, 284
FspBI CTAG 1 cut(s) 328
Hin1II CATG 3 cut(s) 56, 277, 288
HincII GTYRAC 1 cut(s) 169
HindII GTYRAC 1 cut(s) 169
HindIII AAGCTT 1 cut(s) 227
Hpy166II GTNNAC 1 cut(s) 169
Hpy188I TCNGA 1 cut(s) 267
Hpy188III TCNNGA 3 cut(s) 14, 53, 235
Hpy8I GTNNAC 1 cut(s) 169
HpyAV CCTTC 2 cut(s) 157, 232
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 3 cut(s) 185, 302, 321
HpyF10VI GCNNNNNNNGC 1 cut(s) 90
HpyF3I CTNAG 1 cut(s) 173
Hsp92II CATG 3 cut(s) 56, 277, 288
Kzo9I GATC 3 cut(s) 214, 270, 304
LpnPI CCDG 6 cut(s) 20, 42, 58, 185, 195, 297
MaeI CTAG 1 cut(s) 328
MalI GATC 3 cut(s) 216, 272, 306
MboI GATC 3 cut(s) 214, 270, 304
MboII GAAGA 2 cut(s) 254, 280
MflI RGATCY 2 cut(s) 214, 304
MnlI CCTC 4 cut(s) 118, 126, 201, 246
MseI TTAA 1 cut(s) 294
Mva1269I GAATGC 2 cut(s) 84, 304
MwoI GCNNNNNNNGC 1 cut(s) 90
NcoI CCATGG 1 cut(s) 284
NdeII GATC 3 cut(s) 214, 270, 304
NlaIII CATG 3 cut(s) 56, 277, 288
PagI TCATGA 1 cut(s) 52
PctI GAATGC 2 cut(s) 84, 304
PsuI RGATCY 2 cut(s) 214, 304
SaqAI TTAA 1 cut(s) 294
Sau3AI GATC 3 cut(s) 214, 270, 304
SetI ASST 6 cut(s) 52, 168, 174, 179, 193, 231
SmlI CTYRAG 1 cut(s) 192
SmoI CTYRAG 1 cut(s) 192
SspMI CTAG 1 cut(s) 328
StyI CCWWGG 1 cut(s) 284
TaaI ACNGT 1 cut(s) 64
TaqI TCGA 1 cut(s) 66
Tru1I TTAA 1 cut(s) 294
Tru9I TTAA 1 cut(s) 294
XspI CTAG 1 cut(s) 328
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.