Rmu_sc0021546.1_g000001

Nudix hydrolase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021546.1
Physical Location & Seq
Forward (+)
1 .. 1101
1101 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021546.1_g000001.1.cds

Sequence Viewer

Length: 288 bp
gtgttagtagtccaagaaaagggagggcagtatggtgggacaggcgtgtggaagctccctactggagctgtcgatgagggggaagatatctatgcagcagctgtgagagaagttaaagaagaaacaggaattgactcagagtttatagaaattctagcattcagacagatccacaaatcgttctttcagaaatcggatttgttttttctgtgcatgttgcgacccctctcctttgacatccagaagcaggaacaagagatagaagcagccaaggtaatatttggttaa

Protein Analysis

95

Amino Acids

10.69

Weight (kDa)

4.69

Isoelectric Point (pI)

54.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 163
AcsI RAATTY 1 cut(s) 150
AfiI CCNNNNNNNGG 2 cut(s) 19, 247
AluBI AGCT 3 cut(s) 55, 68, 101
AluI AGCT 3 cut(s) 55, 68, 101
AlwI GGATC 1 cut(s) 163
AlwNI CAGNNNCTG 1 cut(s) 101
ApeKI GCWGC 3 cut(s) 95, 98, 266
ApoI RAATTY 1 cut(s) 150
BbvI GCAGC 3 cut(s) 107, 110, 278
BfaI CTAG 1 cut(s) 155
BisI GCNGC 3 cut(s) 96, 99, 267
BlsI GCNGC 3 cut(s) 97, 100, 268
BpmI CTGGAG 1 cut(s) 84
BsaJI CCNNGG 1 cut(s) 270
Bsc4I CCNNNNNNNGG 2 cut(s) 19, 247
Bse1I ACTGG 1 cut(s) 67
BseDI CCNNGG 1 cut(s) 270
BseGI GGATG 1 cut(s) 237
BseLI CCNNNNNNNGG 2 cut(s) 19, 247
BseMII CTCAG 1 cut(s) 150
BseNI ACTGG 1 cut(s) 67
BseXI GCAGC 3 cut(s) 107, 110, 278
BslFI GGGAC 1 cut(s) 52
BslI CCNNNNNNNGG 2 cut(s) 19, 247
BsmFI GGGAC 1 cut(s) 52
BsmI GAATGC 1 cut(s) 158
Bsp143I GATC 1 cut(s) 168
BspCNI CTCAG 1 cut(s) 149
BspPI GGATC 1 cut(s) 163
BsrI ACTGG 1 cut(s) 67
BssECI CCNNGG 1 cut(s) 270
BssMI GATC 1 cut(s) 168
BssT1I CCWWGG 1 cut(s) 270
BstDEI CTNAG 1 cut(s) 136
BstF5I GGATG 1 cut(s) 237
BstKTI GATC 1 cut(s) 171
BstMBI GATC 1 cut(s) 168
BstNSI RCATGY 1 cut(s) 217
BstV1I GCAGC 3 cut(s) 107, 110, 278
BstX2I RGATCY 1 cut(s) 168
BstYI RGATCY 1 cut(s) 168
BtsCI GGATG 1 cut(s) 237
CaiI CAGNNNCTG 1 cut(s) 101
CviAII CATG 1 cut(s) 214
CviJI RGCY 4 cut(s) 55, 68, 101, 269
CviKI_1 RGCY 4 cut(s) 55, 68, 101, 269
DdeI CTNAG 1 cut(s) 136
DpnI GATC 1 cut(s) 170
DpnII GATC 1 cut(s) 168
Eco130I CCWWGG 1 cut(s) 270
Eco32I GATATC 1 cut(s) 88
EcoRV GATATC 1 cut(s) 88
EcoT14I CCWWGG 1 cut(s) 270
ErhI CCWWGG 1 cut(s) 270
FaeI CATG 1 cut(s) 217
FaiI YATR 4 cut(s) 33, 93, 146, 215
FaqI GGGAC 1 cut(s) 52
FatI CATG 1 cut(s) 213
Fnu4HI GCNGC 3 cut(s) 96, 99, 267
FokI GGATG 1 cut(s) 224
Fsp4HI GCNGC 3 cut(s) 96, 99, 267
FspBI CTAG 1 cut(s) 155
GluI GCNGC 3 cut(s) 96, 99, 267
GsuI CTGGAG 1 cut(s) 84
Hin1II CATG 1 cut(s) 217
HinfI GANTC 1 cut(s) 134
Hpy188I TCNGA 4 cut(s) 139, 164, 189, 196
Hpy188III TCNNGA 1 cut(s) 241
HpyCH4V TGCA 2 cut(s) 95, 213
HpyF3I CTNAG 1 cut(s) 136
Hsp92II CATG 1 cut(s) 217
Kzo9I GATC 1 cut(s) 168
LmnI GCTCC 2 cut(s) 60, 65
LpnPI CCDG 5 cut(s) 27, 48, 111, 233, 254
Lsp1109I GCAGC 3 cut(s) 107, 110, 278
MaeI CTAG 1 cut(s) 155
MalI GATC 1 cut(s) 170
MboI GATC 1 cut(s) 168
MboII GAAGA 2 cut(s) 95, 131
MflI RGATCY 1 cut(s) 168
MluCI AATT 2 cut(s) 129, 150
MlyI GAGTC 1 cut(s) 128
MnlI CCTC 3 cut(s) 17, 70, 236
MseI TTAA 2 cut(s) 114, 286
MspA1I CMGCKG 1 cut(s) 101
Mva1269I GAATGC 1 cut(s) 158
NdeII GATC 1 cut(s) 168
NlaIII CATG 1 cut(s) 217
NspI RCATGY 1 cut(s) 217
PctI GAATGC 1 cut(s) 158
PkrI GCNGC 3 cut(s) 97, 100, 268
PleI GAGTC 1 cut(s) 128
PpsI GAGTC 1 cut(s) 128
PstNI CAGNNNCTG 1 cut(s) 101
PsuI RGATCY 1 cut(s) 168
PvuII CAGCTG 1 cut(s) 101
SaqAI TTAA 2 cut(s) 114, 286
SatI GCNGC 3 cut(s) 96, 99, 267
Sau3AI GATC 1 cut(s) 168
SchI GAGTC 1 cut(s) 128
SetI ASST 4 cut(s) 57, 70, 103, 276
Sse9I AATT 2 cut(s) 129, 150
SspI AATATT 1 cut(s) 279
SspMI CTAG 1 cut(s) 155
StyI CCWWGG 1 cut(s) 270
TaqI TCGA 1 cut(s) 72
TasI AATT 2 cut(s) 129, 150
Tru1I TTAA 2 cut(s) 114, 286
Tru9I TTAA 2 cut(s) 114, 286
TseI GCWGC 3 cut(s) 95, 98, 266
XapI RAATTY 1 cut(s) 150
XceI RCATGY 1 cut(s) 217
XspI CTAG 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.