Rmu_sc0025004.1_g000001

Aspartate-semialdehyde

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0025004.1
Physical Location & Seq
Forward (+)
89 .. 787
699 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0025004.1_g000001.1.cds

Sequence Viewer

Length: 420 bp
atggtctatacaacgagaggcaatcctctcgcattccatgaacccaaccttgatgaacttgagattcgatccaagtccctcgtatggcacaccaaggatgtttaccaacttgtagttggcactttctgcagtaaagttataaatattttaacaagtacggacaccgcaaggtatattcggaagaaggctcctggtgtggcggttattgatgtccatgcagctaataacttccctacacctttggaggtgtcaaacaaagatgatgttgcagttggcagaatcagccatgatgtgtcccaggaggggaactatggctacaaatgggaatatctgagcaggttggacatctttgtctgcggtgatcaaaaacgcaagggagctgcacttaatgctgttcagattgctgagctgttgctatag
Functional Annotation

Protein Analysis

139

Amino Acids

15.55

Weight (kDa)

6.9

Isoelectric Point (pI)

22.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 140
AasI GACNNNNNNGTC 1 cut(s) 350
Acc36I ACCTGC 1 cut(s) 327
AciI CCGC 3 cut(s) 165, 200, 357
AclWI GGATC 1 cut(s) 63
AfaI GTAC 1 cut(s) 157
AfiI CCNNNNNNNGG 2 cut(s) 84, 303
AjnI CCWGG 2 cut(s) 190, 297
AluBI AGCT 3 cut(s) 221, 380, 409
AluI AGCT 3 cut(s) 221, 380, 409
AlwI GGATC 1 cut(s) 63
ApeKI GCWGC 2 cut(s) 218, 380
AsuHPI GGTGA 1 cut(s) 371
BbvI GCAGC 2 cut(s) 230, 367
BcgI CGANNNNNNTGC 2 cut(s) 10, 44
BciT130I CCWGG 2 cut(s) 192, 299
BclI TGATCA 1 cut(s) 361
BfmI CTRYAG 2 cut(s) 127, 416
BfuAI ACCTGC 1 cut(s) 327
BisI GCNGC 2 cut(s) 219, 381
BlpI GCTNAGC 1 cut(s) 405
BlsI GCNGC 2 cut(s) 220, 382
Bme1390I CCNGG 2 cut(s) 192, 299
BmiI GGNNCC 1 cut(s) 189
BmrFI CCNGG 2 cut(s) 192, 299
Bpu1102I GCTNAGC 1 cut(s) 405
BpuEI CTTGAG 1 cut(s) 80
BsaJI CCNNGG 2 cut(s) 93, 297
Bsc4I CCNNNNNNNGG 2 cut(s) 84, 303
BseBI CCWGG 2 cut(s) 192, 299
BseDI CCNNGG 2 cut(s) 93, 297
BseGI GGATG 1 cut(s) 103
BseLI CCNNNNNNNGG 2 cut(s) 84, 303
BseMII CTCAG 2 cut(s) 323, 396
BseXI GCAGC 2 cut(s) 230, 367
BsgI GTGCAG 1 cut(s) 366
BslFI GGGAC 2 cut(s) 61, 280
BslI CCNNNNNNNGG 2 cut(s) 84, 303
BsmFI GGGAC 2 cut(s) 61, 280
BsmI GAATGC 1 cut(s) 32
Bsp143I GATC 2 cut(s) 68, 361
Bsp1720I GCTNAGC 1 cut(s) 405
BspACI CCGC 3 cut(s) 165, 200, 357
BspCNI CTCAG 2 cut(s) 324, 397
BspLI GGNNCC 1 cut(s) 189
BspMAI CTGCAG 1 cut(s) 131
BspMI ACCTGC 1 cut(s) 327
BspPI GGATC 1 cut(s) 63
BssECI CCNNGG 2 cut(s) 93, 297
BssMI GATC 2 cut(s) 68, 361
BssT1I CCWWGG 1 cut(s) 93
Bst2UI CCWGG 2 cut(s) 192, 299
BstAPI GCANNNNNTGC 2 cut(s) 126, 389
BstDEI CTNAG 2 cut(s) 332, 405
BstF5I GGATG 1 cut(s) 103
BstKTI GATC 2 cut(s) 71, 364
BstMBI GATC 2 cut(s) 68, 361
BstMWI GCNNNNNNNGC 3 cut(s) 126, 282, 389
BstNI CCWGG 2 cut(s) 192, 299
BstSCI CCNGG 2 cut(s) 190, 297
BstSFI CTRYAG 2 cut(s) 127, 416
BstV1I GCAGC 2 cut(s) 230, 367
BtsCI GGATG 1 cut(s) 103
BveI ACCTGC 1 cut(s) 327
Csp6I GTAC 1 cut(s) 156
CviAII CATG 3 cut(s) 38, 215, 287
CviJI RGCY 6 cut(s) 188, 221, 285, 315, 380, 409
CviKI_1 RGCY 6 cut(s) 188, 221, 285, 315, 380, 409
CviQI GTAC 1 cut(s) 156
DdeI CTNAG 2 cut(s) 332, 405
DpnI GATC 2 cut(s) 70, 363
DpnII GATC 2 cut(s) 68, 361
DrdI GACNNNNNNGTC 1 cut(s) 350
DseDI GACNNNNNNGTC 1 cut(s) 350
Eco130I CCWWGG 1 cut(s) 93
EcoRII CCWGG 2 cut(s) 190, 297
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FaeI CATG 3 cut(s) 41, 218, 290
FaiI YATR 9 cut(s) 9, 39, 85, 140, 174, 216, 288, 312, 418
FaqI GGGAC 2 cut(s) 61, 280
FatI CATG 3 cut(s) 37, 214, 286
FbaI TGATCA 1 cut(s) 361
Fnu4HI GCNGC 2 cut(s) 219, 381
FokI GGATG 1 cut(s) 110
Fsp4HI GCNGC 2 cut(s) 219, 381
GluI GCNGC 2 cut(s) 219, 381
Hin1II CATG 3 cut(s) 41, 218, 290
HinfI GANTC 2 cut(s) 64, 279
HphI GGTGA 1 cut(s) 371
Hpy166II GTNNAC 1 cut(s) 103
Hpy188I TCNGA 3 cut(s) 180, 333, 399
Hpy8I GTNNAC 1 cut(s) 103
HpyAV CCTTC 1 cut(s) 178
HpyCH4V TGCA 4 cut(s) 129, 218, 269, 383
HpyF10VI GCNNNNNNNGC 3 cut(s) 126, 282, 389
HpyF3I CTNAG 2 cut(s) 332, 405
Hsp92II CATG 3 cut(s) 41, 218, 290
Ksp22I TGATCA 1 cut(s) 361
Kzo9I GATC 2 cut(s) 68, 361
LmnI GCTCC 2 cut(s) 193, 377
LpnPI CCDG 5 cut(s) 177, 204, 284, 311, 322
Lsp1109I GCAGC 2 cut(s) 230, 367
MalI GATC 2 cut(s) 70, 363
MboI GATC 2 cut(s) 68, 361
MboII GAAGA 1 cut(s) 193
MmeI TCCRAC 1 cut(s) 321
MnlI CCTC 5 cut(s) 11, 36, 89, 238, 295
MseI TTAA 2 cut(s) 149, 387
MspR9I CCNGG 2 cut(s) 192, 299
Mva1269I GAATGC 1 cut(s) 32
MvaI CCWGG 2 cut(s) 192, 299
MwoI GCNNNNNNNGC 3 cut(s) 126, 282, 389
NdeII GATC 2 cut(s) 68, 361
NlaIII CATG 3 cut(s) 41, 218, 290
NlaIV GGNNCC 1 cut(s) 189
PctI GAATGC 1 cut(s) 32
PfeI GAWTC 2 cut(s) 64, 279
PkrI GCNGC 2 cut(s) 220, 382
PsiI TTATAA 1 cut(s) 140
Psp6I CCWGG 2 cut(s) 190, 297
PspGI CCWGG 2 cut(s) 190, 297
PspN4I GGNNCC 1 cut(s) 189
PsrI GAACNNNNNNTAC 2 cut(s) 299, 331
PstI CTGCAG 1 cut(s) 131
RsaI GTAC 1 cut(s) 157
RsaNI GTAC 1 cut(s) 156
SaqAI TTAA 2 cut(s) 149, 387
SatI GCNGC 2 cut(s) 219, 381
Sau3AI GATC 2 cut(s) 68, 361
ScrFI CCNGG 2 cut(s) 192, 299
SetI ASST 8 cut(s) 51, 173, 223, 241, 249, 341, 382, 411
SfcI CTRYAG 2 cut(s) 127, 416
SmlI CTYRAG 1 cut(s) 59
SmoI CTYRAG 1 cut(s) 59
SsiI CCGC 3 cut(s) 165, 200, 357
SspI AATATT 1 cut(s) 145
StyD4I CCNGG 2 cut(s) 190, 297
StyI CCWWGG 1 cut(s) 93
TaqI TCGA 1 cut(s) 67
TfiI GAWTC 2 cut(s) 64, 279
Tru1I TTAA 2 cut(s) 149, 387
Tru9I TTAA 2 cut(s) 149, 387
TseI GCWGC 2 cut(s) 218, 380
TspDTI ATGAA 2 cut(s) 54, 69
TspGWI ACGGA 1 cut(s) 173
XcmI CCANNNNNNNNNTGG 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.