Rmu_sc0031228.1_g000001

Encodes a close homolog of the Cauliflower OR (Orange) protein. The function of OR is to induce the differentiation of proplastids or other noncolored plastids into chromoplasts for carotenoid accumulation. Both proteins contain a Cysteine-rich

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0031228.1
Physical Location & Seq
Reverse (-)
271 .. 1384
1114 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0031228.1_g000001.1.cds

Sequence Viewer

Length: 282 bp
atggtagttgaaataaacaatgtaaaactgcaggaggataagagatgcaaatattgtcttggaactggatatcttgcttgtgctcggtgttcaagcacaggaaccctcgtgcttgctgaagcagtatcaaccattgatggtggagaacagcctttatcactacctaaaaccgaaagatgttcaaactgctcaggatctggaaaggttatgtgccctacatgcctatgcactgggatggccatggcaagcgagcatgaccctcgaatcgatccctttgattaa

Protein Analysis

93

Amino Acids

9.91

Weight (kDa)

5.29

Isoelectric Point (pI)

45.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 202, 263
AcoI YGGCCR 1 cut(s) 237
AcuI CTGAAG 1 cut(s) 138
AgsI TTSAA 3 cut(s) 11, 93, 183
Alw21I GWGCWC 1 cut(s) 85
AlwI GGATC 2 cut(s) 202, 263
AlwNI CAGNNNCTG 1 cut(s) 197
AoxI GGCC 1 cut(s) 237
BaeGI GKGCMC 1 cut(s) 215
BalI TGGCCA 1 cut(s) 239
BauI CACGAG 1 cut(s) 107
Bbv12I GWGCWC 1 cut(s) 85
BccI CCATC 2 cut(s) 131, 229
BcgI CGANNNNNNTGC 2 cut(s) 242, 276
BfmI CTRYAG 1 cut(s) 29
BmiI GGNNCC 1 cut(s) 103
BmrI ACTGGG 1 cut(s) 240
BmsI GCATC 1 cut(s) 35
BmuI ACTGGG 1 cut(s) 240
Bpu10I CCTNAGC 1 cut(s) 190
Bsa29I ATCGAT 1 cut(s) 267
BsaJI CCNNGG 1 cut(s) 240
Bse1I ACTGG 2 cut(s) 70, 235
BseCI ATCGAT 1 cut(s) 267
BseDI CCNNGG 1 cut(s) 240
BseGI GGATG 1 cut(s) 240
BseMII CTCAG 1 cut(s) 204
BseNI ACTGG 2 cut(s) 70, 235
BseSI GKGCMC 1 cut(s) 215
BshFI GGCC 1 cut(s) 239
BshVI ATCGAT 1 cut(s) 267
BsiHKAI GWGCWC 1 cut(s) 85
BsnI GGCC 1 cut(s) 239
Bsp1286I GDGCHC 2 cut(s) 85, 215
Bsp143I GATC 2 cut(s) 194, 268
Bsp19I CCATGG 1 cut(s) 240
BspANI GGCC 1 cut(s) 239
BspCNI CTCAG 1 cut(s) 203
BspDI ATCGAT 1 cut(s) 267
BspLI GGNNCC 1 cut(s) 103
BspMAI CTGCAG 1 cut(s) 33
BspPI GGATC 2 cut(s) 202, 263
BsrI ACTGG 2 cut(s) 70, 235
BssECI CCNNGG 1 cut(s) 240
BssMI GATC 2 cut(s) 194, 268
BssSI CACGAG 1 cut(s) 107
BssT1I CCWWGG 1 cut(s) 240
Bst2BI CACGAG 1 cut(s) 107
BstC8I GCNNGC 3 cut(s) 114, 247, 251
BstDEI CTNAG 1 cut(s) 190
BstDSI CCRYGG 1 cut(s) 240
BstF5I GGATG 1 cut(s) 240
BstKTI GATC 2 cut(s) 197, 271
BstMBI GATC 2 cut(s) 194, 268
BstMWI GCNNNNNNNGC 1 cut(s) 219
BstNSI RCATGY 1 cut(s) 222
BstSFI CTRYAG 1 cut(s) 29
BstSLI GKGCMC 1 cut(s) 215
BstX2I RGATCY 1 cut(s) 194
BstYI RGATCY 1 cut(s) 194
Bsu15I ATCGAT 1 cut(s) 267
BsuRI GGCC 1 cut(s) 239
BsuTUI ATCGAT 1 cut(s) 267
BtgI CCRYGG 1 cut(s) 240
BtsCI GGATG 1 cut(s) 240
BtsIMutI CAGTG 1 cut(s) 228
Cac8I GCNNGC 3 cut(s) 114, 247, 251
CaiI CAGNNNCTG 1 cut(s) 197
ClaI ATCGAT 1 cut(s) 267
CviAII CATG 3 cut(s) 219, 241, 254
CviJI RGCY 2 cut(s) 151, 239
CviKI_1 RGCY 2 cut(s) 151, 239
DdeI CTNAG 1 cut(s) 190
DpnI GATC 2 cut(s) 196, 270
DpnII GATC 2 cut(s) 194, 268
EaeI YGGCCR 1 cut(s) 237
Eco130I CCWWGG 1 cut(s) 240
Eco32I GATATC 1 cut(s) 71
Eco57I CTGAAG 1 cut(s) 138
EcoRV GATATC 1 cut(s) 71
EcoT14I CCWWGG 1 cut(s) 240
ErhI CCWWGG 1 cut(s) 240
FaeI CATG 3 cut(s) 222, 244, 257
FaiI YATR 5 cut(s) 209, 220, 226, 242, 255
FatI CATG 3 cut(s) 218, 240, 253
FokI GGATG 1 cut(s) 247
HaeIII GGCC 1 cut(s) 239
Hin1II CATG 3 cut(s) 222, 244, 257
HinfI GANTC 1 cut(s) 264
Hpy188III TCNNGA 2 cut(s) 192, 198
HpyCH4V TGCA 3 cut(s) 31, 48, 228
HpyF10VI GCNNNNNNNGC 1 cut(s) 219
HpyF3I CTNAG 1 cut(s) 190
Hsp92II CATG 3 cut(s) 222, 244, 257
Kzo9I GATC 2 cut(s) 194, 268
LpnPI CCDG 6 cut(s) 17, 51, 84, 177, 183, 216
LweI GCATC 1 cut(s) 35
MalI GATC 2 cut(s) 196, 270
MboI GATC 2 cut(s) 194, 268
MflI RGATCY 1 cut(s) 194
MhlI GDGCHC 2 cut(s) 85, 215
MlsI TGGCCA 1 cut(s) 239
MluNI TGGCCA 1 cut(s) 239
MnlI CCTC 3 cut(s) 28, 116, 270
Mox20I TGGCCA 1 cut(s) 239
MscI TGGCCA 1 cut(s) 239
MseI TTAA 1 cut(s) 280
MslI CAYNNNNRTG 2 cut(s) 223, 233
Msp20I TGGCCA 1 cut(s) 239
MwoI GCNNNNNNNGC 1 cut(s) 219
NcoI CCATGG 1 cut(s) 240
NdeII GATC 2 cut(s) 194, 268
NlaIII CATG 3 cut(s) 222, 244, 257
NlaIV GGNNCC 1 cut(s) 103
NspI RCATGY 1 cut(s) 222
PfeI GAWTC 1 cut(s) 264
PspN4I GGNNCC 1 cut(s) 103
PstI CTGCAG 1 cut(s) 33
PstNI CAGNNNCTG 1 cut(s) 197
PsuI RGATCY 1 cut(s) 194
RseI CAYNNNNRTG 2 cut(s) 223, 233
SaqAI TTAA 1 cut(s) 280
Sau3AI GATC 2 cut(s) 194, 268
SduI GDGCHC 2 cut(s) 85, 215
SetI ASST 2 cut(s) 166, 207
SfaNI GCATC 1 cut(s) 35
SfcI CTRYAG 1 cut(s) 29
SmiMI CAYNNNNRTG 2 cut(s) 223, 233
SspI AATATT 1 cut(s) 53
StyI CCWWGG 1 cut(s) 240
TaqI TCGA 2 cut(s) 262, 267
TfiI GAWTC 1 cut(s) 264
Tru1I TTAA 1 cut(s) 280
Tru9I TTAA 1 cut(s) 280
TscAI CASTG 1 cut(s) 235
TspRI CASTG 1 cut(s) 235
XceI RCATGY 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.