Rmu_sc0031410.1_g000001

Peptidyl-prolyl cis-trans isomerase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0031410.1
Physical Location & Seq
Reverse (-)
1 .. 1099
1099 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0031410.1_g000001.1.cds

Sequence Viewer

Length: 667 bp
atgaagaaaggtgagaatgcccttttcaccattcctcctgatatggcttatggtgcgtctggatctcccccaaccatccctccaaatgcaacgttgcagttcgatgttgaattgctatcgtggaccagtgtaaacgacataaccaaggatggtggaattattaagaaggttttgaaagagggagaaaaatgggagaacccaaaagaccttgatgaagtcatagttaaatttgaggcccagctcgaagataaaacacttgtagcaaaatctgacaccgtggaattcactgtcaaagagggttacttctgtcctgcattggcaaaggcagttaaaacaatgaagaagagcgaaaaagtattgttgacggtgaaaccacaatatggatttggggacaagggtaagcctgcatctggtgatgagggtgctgttcctccaaatgcaactcttcatattactctagagttggtatcgtggagaacagtctcagaactgacagatgacaagaaagttacgaagaagatcctaaaagaaggggaagggtatgagcgtccaaatgaaggagctgttgttacagtgaaattgattggaaagttgcaagatggtaaggaatttttaaagaaaggtcatggtgaaggagaagaaccatttgagttcaagacagatgagg

Protein Analysis

222

Amino Acids

24.4

Weight (kDa)

5.37

Isoelectric Point (pI)

15.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 380
AclI AACGTT 1 cut(s) 92
AclWI GGATC 2 cut(s) 70, 514
AcsI RAATTY 3 cut(s) 227, 281, 608
AfiI CCNNNNNNNGG 3 cut(s) 380, 410, 557
AgsI TTSAA 3 cut(s) 110, 175, 655
AluBI AGCT 2 cut(s) 241, 563
AluI AGCT 2 cut(s) 241, 563
Alw26I GTCTC 1 cut(s) 487
AlwI GGATC 2 cut(s) 70, 514
AoxI GGCC 1 cut(s) 234
ApoI RAATTY 3 cut(s) 227, 281, 608
AspS9I GGNCC 2 cut(s) 123, 235
AsuHPI GGTGA 5 cut(s) 19, 23, 379, 425, 641
AvaII GGWCC 1 cut(s) 123
BccI CCATC 3 cut(s) 83, 143, 593
BcoDI GTCTC 1 cut(s) 487
BfaI CTAG 1 cut(s) 458
Bme18I GGWCC 1 cut(s) 123
BmgT120I GGNCC 2 cut(s) 123, 235
BmsI GCATC 1 cut(s) 416
BsaJI CCNNGG 2 cut(s) 144, 276
BsaXI ACNNNNNCTCC 6 cut(s) 19, 49, 64, 94, 552, 582
Bsc4I CCNNNNNNNGG 3 cut(s) 380, 410, 557
Bse1I ACTGG 1 cut(s) 126
BseDI CCNNGG 2 cut(s) 144, 276
BseGI GGATG 2 cut(s) 75, 154
BseLI CCNNNNNNNGG 3 cut(s) 380, 410, 557
BseMII CTCAG 1 cut(s) 498
BseNI ACTGG 1 cut(s) 126
BseYI CCCAGC 1 cut(s) 237
BshFI GGCC 1 cut(s) 236
BslFI GGGAC 1 cut(s) 404
BslI CCNNNNNNNGG 3 cut(s) 380, 410, 557
BsmAI GTCTC 1 cut(s) 487
BsmFI GGGAC 1 cut(s) 404
BsmI GAATGC 1 cut(s) 22
BsnI GGCC 1 cut(s) 236
Bsp143I GATC 2 cut(s) 62, 519
BspANI GGCC 1 cut(s) 236
BspCNI CTCAG 1 cut(s) 497
BspPI GGATC 2 cut(s) 70, 514
BspQI GCTCTTC 1 cut(s) 338
BsrI ACTGG 1 cut(s) 126
BssECI CCNNGG 2 cut(s) 144, 276
BssMI GATC 2 cut(s) 62, 519
BssT1I CCWWGG 1 cut(s) 144
Bst4CI ACNGT 5 cut(s) 277, 289, 367, 481, 574
Bst6I CTCTTC 2 cut(s) 338, 450
BstC8I GCNNGC 1 cut(s) 405
BstDEI CTNAG 1 cut(s) 484
BstDSI CCRYGG 1 cut(s) 276
BstF5I GGATG 2 cut(s) 75, 154
BstKTI GATC 2 cut(s) 65, 522
BstMAI GTCTC 1 cut(s) 487
BstMBI GATC 2 cut(s) 62, 519
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstX2I RGATCY 2 cut(s) 62, 519
BstYI RGATCY 2 cut(s) 62, 519
BsuRI GGCC 1 cut(s) 236
BtgI CCRYGG 1 cut(s) 276
BtsCI GGATG 2 cut(s) 75, 154
BtsIMutI CAGTG 3 cut(s) 133, 285, 579
Cac8I GCNNGC 1 cut(s) 405
Cfr13I GGNCC 2 cut(s) 123, 235
CseI GACGC 2 cut(s) 45, 536
CspCI CAANNNNNGTGG 2 cut(s) 133, 168
CviAII CATG 1 cut(s) 626
CviJI RGCY 5 cut(s) 47, 236, 241, 403, 563
CviKI_1 RGCY 5 cut(s) 47, 236, 241, 403, 563
DdeI CTNAG 1 cut(s) 484
DpnI GATC 2 cut(s) 64, 521
DpnII GATC 2 cut(s) 62, 519
DraI TTTAAA 1 cut(s) 615
Eam1104I CTCTTC 2 cut(s) 338, 450
EarI CTCTTC 2 cut(s) 338, 450
Eco130I CCWWGG 1 cut(s) 144
Eco47I GGWCC 1 cut(s) 123
EcoRI GAATTC 1 cut(s) 281
EcoT14I CCWWGG 1 cut(s) 144
ErhI CCWWGG 1 cut(s) 144
FaeI CATG 1 cut(s) 629
FaiI YATR 8 cut(s) 44, 51, 140, 221, 381, 450, 543, 627
FaqI GGGAC 1 cut(s) 404
FatI CATG 1 cut(s) 625
FokI GGATG 2 cut(s) 62, 161
FspBI CTAG 1 cut(s) 458
GsaI CCCAGC 1 cut(s) 241
HaeIII GGCC 1 cut(s) 236
HgaI GACGC 2 cut(s) 45, 536
Hin1II CATG 1 cut(s) 629
HincII GTYRAC 1 cut(s) 363
HindII GTYRAC 1 cut(s) 363
HphI GGTGA 5 cut(s) 19, 23, 379, 425, 641
Hpy166II GTNNAC 3 cut(s) 123, 133, 363
Hpy188I TCNGA 2 cut(s) 271, 487
Hpy188III TCNNGA 4 cut(s) 38, 60, 458, 655
Hpy8I GTNNAC 3 cut(s) 123, 133, 363
HpyAV CCTTC 5 cut(s) 160, 524, 530, 551, 626
HpyCH4III ACNGT 5 cut(s) 277, 289, 367, 481, 574
HpyCH4IV ACGT 1 cut(s) 92
HpyCH4V TGCA 6 cut(s) 89, 97, 314, 407, 440, 595
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 484
HpySE526I ACGT 1 cut(s) 92
Hsp92II CATG 1 cut(s) 629
Kzo9I GATC 2 cut(s) 62, 519
LguI GCTCTTC 1 cut(s) 338
LmnI GCTCC 1 cut(s) 560
LpnPI CCDG 7 cut(s) 45, 51, 139, 251, 324, 396, 417
LweI GCATC 1 cut(s) 416
MaeI CTAG 1 cut(s) 458
MaeII ACGT 1 cut(s) 92
MaeIII GTNAC 3 cut(s) 299, 508, 568
MalI GATC 2 cut(s) 64, 521
MboI GATC 2 cut(s) 62, 519
MboII GAAGA 8 cut(s) 16, 257, 352, 355, 437, 526, 529, 650
MflI RGATCY 2 cut(s) 62, 519
MluCI AATT 6 cut(s) 110, 156, 227, 281, 578, 608
MnlI CCTC 8 cut(s) 45, 90, 172, 226, 289, 412, 441, 658
MseI TTAA 4 cut(s) 162, 225, 330, 614
Mva1269I GAATGC 1 cut(s) 22
MwoI GCNNNNNNNGC 1 cut(s) 53
NdeII GATC 2 cut(s) 62, 519
NlaIII CATG 1 cut(s) 629
PciSI GCTCTTC 1 cut(s) 338
PctI GAATGC 1 cut(s) 22
PflMI CCANNNNNTGG 1 cut(s) 380
Psp1406I AACGTT 1 cut(s) 92
PspFI CCCAGC 1 cut(s) 237
PspPI GGNCC 2 cut(s) 123, 235
PsuI RGATCY 2 cut(s) 62, 519
SapI GCTCTTC 1 cut(s) 338
SaqAI TTAA 4 cut(s) 162, 225, 330, 614
Sau3AI GATC 2 cut(s) 62, 519
Sau96I GGNCC 2 cut(s) 123, 235
SetI ASST 7 cut(s) 13, 95, 171, 210, 243, 565, 625
SfaNI GCATC 1 cut(s) 416
SinI GGWCC 1 cut(s) 123
Sse9I AATT 6 cut(s) 110, 156, 227, 281, 578, 608
SspMI CTAG 1 cut(s) 458
StyI CCWWGG 1 cut(s) 144
TaaI ACNGT 5 cut(s) 277, 289, 367, 481, 574
TaiI ACGT 1 cut(s) 95
TaqI TCGA 2 cut(s) 102, 243
TasI AATT 6 cut(s) 110, 156, 227, 281, 578, 608
Tru1I TTAA 4 cut(s) 162, 225, 330, 614
Tru9I TTAA 4 cut(s) 162, 225, 330, 614
TscAI CASTG 3 cut(s) 133, 292, 579
TspDTI ATGAA 5 cut(s) 17, 228, 353, 437, 570
TspRI CASTG 3 cut(s) 133, 292, 579
Van91I CCANNNNNTGG 1 cut(s) 380
VpaK11BI GGWCC 1 cut(s) 123
XapI RAATTY 3 cut(s) 227, 281, 608
XbaI TCTAGA 1 cut(s) 457
XspI CTAG 1 cut(s) 458
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.