Rmu_sc0031476.1_g000001
ERF Family

Probably involved in the RNA silencing pathway and required for the generation of small interfering RNAs (siRNAs)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0031476.1
Physical Location & Seq
Reverse (-)
2 .. 309
308 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0031476.1_g000001.1.cds

Sequence Viewer

Length: 308 bp
atgttaagacttgggggattttggttttctcagctcaagtttggcccaaagatttttcggaaagtatcaggacctaatgtagcttccaagtttggtgctgatcggtatcacttttgcaaggaagactttgattatctgtgggtgaggactacagatttttctgagacaaagtcgattggccattcgacttcgttttgctgggagattcaggaggactttttggtggcgggtctttttatgaagtttccgagctttaggaaagatgtggtggatctcatgtttgaggatggtgatgggtatctttcggt

Protein Analysis

103

Amino Acids

12.0

Weight (kDa)

6.07

Isoelectric Point (pI)

24.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 227
AclWI GGATC 1 cut(s) 279
AcoI YGGCCR 1 cut(s) 178
AluBI AGCT 3 cut(s) 34, 83, 252
AluI AGCT 3 cut(s) 34, 83, 252
Alw26I GTCTC 1 cut(s) 158
AlwI GGATC 1 cut(s) 279
AoxI GGCC 2 cut(s) 43, 178
AspS9I GGNCC 2 cut(s) 44, 71
AsuHPI GGTGA 2 cut(s) 154, 302
AvaII GGWCC 1 cut(s) 71
BalI TGGCCA 1 cut(s) 180
BbsI GAAGAC 1 cut(s) 129
BccI CCATC 2 cut(s) 281, 287
BcoDI GTCTC 1 cut(s) 158
BfmI CTRYAG 1 cut(s) 150
Bme18I GGWCC 1 cut(s) 71
BmgT120I GGNCC 2 cut(s) 44, 71
BpiI GAAGAC 1 cut(s) 129
BpuEI CTTGAG 1 cut(s) 20
BsaBI GATNNNNATC 2 cut(s) 105, 297
Bse8I GATNNNNATC 2 cut(s) 105, 297
BseGI GGATG 1 cut(s) 292
BseJI GATNNNNATC 2 cut(s) 105, 297
BseMII CTCAG 2 cut(s) 44, 153
BseYI CCCAGC 1 cut(s) 198
BshFI GGCC 2 cut(s) 45, 180
BsmAI GTCTC 1 cut(s) 158
BsnI GGCC 2 cut(s) 45, 180
Bsp143I GATC 2 cut(s) 100, 271
BspACI CCGC 1 cut(s) 227
BspANI GGCC 2 cut(s) 45, 180
BspCNI CTCAG 2 cut(s) 43, 154
BspPI GGATC 1 cut(s) 279
BssMI GATC 2 cut(s) 100, 271
BstDEI CTNAG 2 cut(s) 30, 162
BstF5I GGATG 1 cut(s) 292
BstKTI GATC 2 cut(s) 103, 274
BstMAI GTCTC 1 cut(s) 158
BstMBI GATC 2 cut(s) 100, 271
BstSFI CTRYAG 1 cut(s) 150
BstV2I GAAGAC 1 cut(s) 129
BstX2I RGATCY 1 cut(s) 271
BstYI RGATCY 1 cut(s) 271
BsuRI GGCC 2 cut(s) 45, 180
BtsCI GGATG 1 cut(s) 292
Cfr13I GGNCC 2 cut(s) 44, 71
CviAII CATG 1 cut(s) 277
CviJI RGCY 5 cut(s) 34, 45, 83, 180, 252
CviKI_1 RGCY 5 cut(s) 34, 45, 83, 180, 252
DdeI CTNAG 2 cut(s) 30, 162
DpnI GATC 2 cut(s) 102, 273
DpnII GATC 2 cut(s) 100, 271
EaeI YGGCCR 1 cut(s) 178
Eco47I GGWCC 1 cut(s) 71
EcoO109I RGGNCCY 1 cut(s) 71
FaeI CATG 1 cut(s) 280
FaiI YATR 2 cut(s) 239, 278
FalI AAGNNNNNCTT 2 cut(s) 110, 142
FatI CATG 1 cut(s) 276
FauI CCCGC 1 cut(s) 220
FokI GGATG 1 cut(s) 299
GsaI CCCAGC 1 cut(s) 202
HaeIII GGCC 2 cut(s) 45, 180
Hin1II CATG 1 cut(s) 280
HinfI GANTC 1 cut(s) 205
HphI GGTGA 2 cut(s) 154, 302
Hpy188I TCNGA 3 cut(s) 60, 163, 249
Hpy188III TCNNGA 2 cut(s) 69, 209
HpyCH4V TGCA 1 cut(s) 117
HpyF3I CTNAG 2 cut(s) 30, 162
Hsp92II CATG 1 cut(s) 280
Kzo9I GATC 2 cut(s) 100, 271
LpnPI CCDG 3 cut(s) 54, 184, 194
MalI GATC 2 cut(s) 102, 273
MboI GATC 2 cut(s) 100, 271
MboII GAAGA 1 cut(s) 134
MflI RGATCY 1 cut(s) 271
MlsI TGGCCA 1 cut(s) 180
MluNI TGGCCA 1 cut(s) 180
MnlI CCTC 3 cut(s) 138, 205, 277
Mox20I TGGCCA 1 cut(s) 180
MscI TGGCCA 1 cut(s) 180
MseI TTAA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 180
NdeII GATC 2 cut(s) 100, 271
NlaIII CATG 1 cut(s) 280
PfeI GAWTC 1 cut(s) 205
PflFI GACNNNGTC 1 cut(s) 169
PpuMI RGGWCCY 1 cut(s) 71
Psp5II RGGWCCY 1 cut(s) 71
PspFI CCCAGC 1 cut(s) 198
PspPI GGNCC 2 cut(s) 44, 71
PspPPI RGGWCCY 1 cut(s) 71
PsuI RGATCY 1 cut(s) 271
PsyI GACNNNGTC 1 cut(s) 169
SaqAI TTAA 1 cut(s) 5
Sau3AI GATC 2 cut(s) 100, 271
Sau96I GGNCC 2 cut(s) 44, 71
SetI ASST 4 cut(s) 36, 76, 85, 254
SfcI CTRYAG 1 cut(s) 150
SinI GGWCC 1 cut(s) 71
SmlI CTYRAG 1 cut(s) 35
SmoI CTYRAG 1 cut(s) 35
SsiI CCGC 1 cut(s) 227
TaqI TCGA 2 cut(s) 173, 185
TfiI GAWTC 1 cut(s) 205
Tru1I TTAA 1 cut(s) 5
Tru9I TTAA 1 cut(s) 5
TspDTI ATGAA 1 cut(s) 254
Tth111I GACNNNGTC 1 cut(s) 169
VpaK11BI GGWCC 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.