Rmu_sc0039110.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0039110.1
Physical Location & Seq
Reverse (-)
371 .. 843
473 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0039110.1_g000001.1.cds

Sequence Viewer

Length: 369 bp
atggtagttggagtgatttcggccgccaccgaaattccttttcatggtggctatctgggcttcccttggttgaattctgaccctagttcatatttaaaaatggttggagagaagaagaagaagatgatgatgatgaagaatagtggaaacgggaagattcacaaaggaaatgagagagagaatcaggtgaagaaggacaagaaatcaggatcgggcatgaatggatcgcccaagaaaggtggccatggcggcaagctcacctgggctggtgatctgggctactctatagctgagatgggttttcagaaggaagtcatcgactctaaggatccaaactttgaagacacagttaagatcccaagcgtttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

122

Amino Acids

13.24

Weight (kDa)

9.49

Isoelectric Point (pI)

16.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 24, 249
AclWI GGATC 5 cut(s) 217, 232, 323, 336, 349
AcoI YGGCCR 2 cut(s) 21, 241
AcsI RAATTY 2 cut(s) 33, 73
AfiI CCNNNNNNNGG 2 cut(s) 44, 236
AgsI TTSAA 2 cut(s) 73, 341
AjnI CCWGG 1 cut(s) 260
AluBI AGCT 2 cut(s) 256, 290
AluI AGCT 2 cut(s) 256, 290
AlwI GGATC 5 cut(s) 217, 232, 323, 336, 349
AoxI GGCC 2 cut(s) 21, 241
ApoI RAATTY 2 cut(s) 33, 73
AsuHPI GGTGA 3 cut(s) 199, 250, 281
BalI TGGCCA 1 cut(s) 243
BamHI GGATCC 1 cut(s) 328
BbsI GAAGAC 1 cut(s) 348
BccI CCATC 1 cut(s) 289
BciT130I CCWGG 1 cut(s) 262
BfaI CTAG 1 cut(s) 84
BfmI CTRYAG 1 cut(s) 285
BglI GCCNNNNNGGC 1 cut(s) 249
BisI GCNGC 2 cut(s) 24, 250
BlsI GCNGC 2 cut(s) 25, 251
Bme1390I CCNGG 1 cut(s) 262
BmiI GGNNCC 1 cut(s) 330
BmrFI CCNGG 1 cut(s) 262
BpiI GAAGAC 1 cut(s) 348
BsaJI CCNNGG 3 cut(s) 65, 244, 261
Bsc4I CCNNNNNNNGG 2 cut(s) 44, 236
BseBI CCWGG 1 cut(s) 262
BseDI CCNNGG 3 cut(s) 65, 244, 261
BseLI CCNNNNNNNGG 2 cut(s) 44, 236
BseMII CTCAG 1 cut(s) 282
BseX3I CGGCCG 1 cut(s) 21
Bsh1285I CGRYCG 1 cut(s) 24
BshFI GGCC 2 cut(s) 23, 243
BsiEI CGRYCG 1 cut(s) 24
BslI CCNNNNNNNGG 2 cut(s) 44, 236
BsnI GGCC 2 cut(s) 23, 243
Bsp143I GATC 5 cut(s) 209, 224, 271, 328, 354
Bsp19I CCATGG 1 cut(s) 244
BspACI CCGC 2 cut(s) 24, 249
BspANI GGCC 2 cut(s) 23, 243
BspCNI CTCAG 1 cut(s) 283
BspLI GGNNCC 1 cut(s) 330
BspPI GGATC 5 cut(s) 217, 232, 323, 336, 349
BssECI CCNNGG 3 cut(s) 65, 244, 261
BssMI GATC 5 cut(s) 209, 224, 271, 328, 354
BssT1I CCWWGG 2 cut(s) 65, 244
Bst2UI CCWGG 1 cut(s) 262
Bst4CI ACNGT 1 cut(s) 349
BstC8I GCNNGC 1 cut(s) 254
BstDEI CTNAG 2 cut(s) 291, 324
BstDSI CCRYGG 1 cut(s) 244
BstKTI GATC 5 cut(s) 212, 227, 274, 331, 357
BstMBI GATC 5 cut(s) 209, 224, 271, 328, 354
BstMCI CGRYCG 1 cut(s) 24
BstMWI GCNNNNNNNGC 2 cut(s) 57, 249
BstNI CCWGG 1 cut(s) 262
BstSCI CCNGG 1 cut(s) 260
BstSFI CTRYAG 1 cut(s) 285
BstV2I GAAGAC 1 cut(s) 348
BstX2I RGATCY 2 cut(s) 328, 354
BstYI RGATCY 2 cut(s) 328, 354
BstZI CGGCCG 1 cut(s) 21
BsuRI GGCC 2 cut(s) 23, 243
BtgI CCRYGG 1 cut(s) 244
Cac8I GCNNGC 1 cut(s) 254
CspCI CAANNNNNGTGG 2 cut(s) 220, 255
CviAII CATG 3 cut(s) 44, 217, 245
CviJI RGCY 8 cut(s) 23, 51, 60, 243, 256, 266, 279, 290
CviKI_1 RGCY 8 cut(s) 23, 51, 60, 243, 256, 266, 279, 290
DdeI CTNAG 2 cut(s) 291, 324
DpnI GATC 5 cut(s) 211, 226, 273, 330, 356
DpnII GATC 5 cut(s) 209, 224, 271, 328, 354
DraI TTTAAA 1 cut(s) 96
EaeI YGGCCR 2 cut(s) 21, 241
EagI CGGCCG 1 cut(s) 21
EclXI CGGCCG 1 cut(s) 21
Eco130I CCWWGG 2 cut(s) 65, 244
Eco52I CGGCCG 1 cut(s) 21
EcoRI GAATTC 1 cut(s) 73
EcoRII CCWGG 1 cut(s) 260
EcoT14I CCWWGG 2 cut(s) 65, 244
ErhI CCWWGG 2 cut(s) 65, 244
FaeI CATG 3 cut(s) 47, 220, 248
FaiI YATR 5 cut(s) 45, 91, 218, 246, 287
FatI CATG 3 cut(s) 43, 216, 244
Fnu4HI GCNGC 2 cut(s) 24, 250
Fsp4HI GCNGC 2 cut(s) 24, 250
FspBI CTAG 1 cut(s) 84
GluI GCNGC 2 cut(s) 24, 250
HaeIII GGCC 2 cut(s) 23, 243
Hin1II CATG 3 cut(s) 47, 220, 248
HinfI GANTC 3 cut(s) 157, 181, 320
HphI GGTGA 3 cut(s) 199, 250, 281
Hpy188I TCNGA 2 cut(s) 79, 306
Hpy188III TCNNGA 1 cut(s) 207
HpyAV CCTTC 2 cut(s) 187, 301
HpyCH4III ACNGT 1 cut(s) 349
HpyF10VI GCNNNNNNNGC 2 cut(s) 57, 249
HpyF3I CTNAG 2 cut(s) 291, 324
Hsp92II CATG 3 cut(s) 47, 220, 248
Kzo9I GATC 5 cut(s) 209, 224, 271, 328, 354
LpnPI CCDG 7 cut(s) 41, 170, 192, 247, 252, 260, 274
MaeI CTAG 1 cut(s) 84
MalI GATC 5 cut(s) 211, 226, 273, 330, 356
MboI GATC 5 cut(s) 209, 224, 271, 328, 354
MboII GAAGA 8 cut(s) 124, 127, 130, 133, 148, 166, 202, 353
MflI RGATCY 2 cut(s) 328, 354
MlsI TGGCCA 1 cut(s) 243
MluCI AATT 2 cut(s) 33, 73
MluNI TGGCCA 1 cut(s) 243
MlyI GAGTC 1 cut(s) 314
MmeI TCCRAC 1 cut(s) 85
Mox20I TGGCCA 1 cut(s) 243
MscI TGGCCA 1 cut(s) 243
MseI TTAA 2 cut(s) 95, 351
Msp20I TGGCCA 1 cut(s) 243
MspR9I CCNGG 1 cut(s) 262
MvaI CCWGG 1 cut(s) 262
MwoI GCNNNNNNNGC 2 cut(s) 57, 249
NcoI CCATGG 1 cut(s) 244
NdeII GATC 5 cut(s) 209, 224, 271, 328, 354
NlaIII CATG 3 cut(s) 47, 220, 248
NlaIV GGNNCC 1 cut(s) 330
PfeI GAWTC 2 cut(s) 157, 181
PkrI GCNGC 2 cut(s) 25, 251
PleI GAGTC 1 cut(s) 314
PpsI GAGTC 1 cut(s) 314
Psp6I CCWGG 1 cut(s) 260
PspGI CCWGG 1 cut(s) 260
PspN4I GGNNCC 1 cut(s) 330
PsuI RGATCY 2 cut(s) 328, 354
SaqAI TTAA 2 cut(s) 95, 351
SatI GCNGC 2 cut(s) 24, 250
Sau3AI GATC 5 cut(s) 209, 224, 271, 328, 354
SchI GAGTC 1 cut(s) 314
ScrFI CCNGG 1 cut(s) 262
SetI ASST 5 cut(s) 189, 241, 258, 263, 292
SfcI CTRYAG 1 cut(s) 285
Sse9I AATT 2 cut(s) 33, 73
SsiI CCGC 2 cut(s) 24, 249
SspMI CTAG 1 cut(s) 84
StyD4I CCNGG 1 cut(s) 260
StyI CCWWGG 2 cut(s) 65, 244
TaaI ACNGT 1 cut(s) 349
TaqI TCGA 1 cut(s) 318
TasI AATT 2 cut(s) 33, 73
TauI GCSGC 2 cut(s) 26, 252
TfiI GAWTC 2 cut(s) 157, 181
Tru1I TTAA 2 cut(s) 95, 351
Tru9I TTAA 2 cut(s) 95, 351
TspDTI ATGAA 4 cut(s) 32, 78, 149, 233
XapI RAATTY 2 cut(s) 33, 73
XspI CTAG 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.