Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0040922.1

Orthogroup ID

OG0003735

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 501

Gene Structure 500 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0040922.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 341 bp

atgatacttggtgctcctttggaagatgctcgtcatcttgctcaacgttatagtcgaatgcggcaggaagcagagacacaggcagttgaagtttccagaaggctagcacgagttaaagaaatcccaaatccagaaaatgttggaaagctgcatgcagcagaaacaaagatgaaagaaataaaagcaaatatggcagttctgggtatagaagcttcggctgccttggctgctgtggaagcacagcagcaaagactaacatttcagaggcttgttgcactggttgaaggagaaaagaattatcatctgagagtggctgccattcttggtgaggttgaagctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SH3_1 SH3_9

Protein Analysis

113

Amino Acids

12.51

Weight (kDa)

8.1

Isoelectric Point (pI)

41.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003735)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G39020
fragaria_vesca	FvH4_2g10160 FvH4_2g10160 FvH4_2g10160 FvH4_2g10160 FvH4_2g10160 FvH4_3g27182
malus_domestica	MD05G1056500.v1.1 MD10G1064500.v1.1
prunus_persica	Prupe.8G086700_v2.0.a1 Prupe.8G086700_v2.0.a1
pyrus_communis	pycom05g04810 pycom10g05040
rosa_chinensis	RchiOBHm_Chr2g0102681 RchiOBHm_Chr6g0267341
rosa_laevigata	RLG00000014014
rosa_multiflora	Rmu_co8352115.1_g000001 Rmu_co8477675.1_g000001 Rmu_sc0000693.1_g000022 Rmu_sc0002077.1_g000001 Rmu_sc0002639.1_g000012 Rmu_sc0008034.1_g000007 Rmu_sc0028141.1_g000001 Rmu_sc0040922.1_g000001
rosa_roxburghii	Rroxscaffold_3G00266630 Rroxscaffold_7G00200930
rosa_rugosa	Rorug02G0109200 Rorug06G0031400
rosa_samantha	Rh2CG163000 Rh6AG153300 Rh6BG153000 Rh6CG149200 Rh6DG137400
rosa_wichuraiana	Rw6G013190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	61
AclI	AACGTT	1 cut(s)	46
AgsI	TTSAA	3 cut(s)	89, 284, 335
AluBI	AGCT	3 cut(s)	148, 212, 338
AluI	AGCT	3 cut(s)	148, 212, 338
Alw21I	GWGCWC	1 cut(s)	16
Alw26I	GTCTC	1 cut(s)	68
ApeKI	GCWGC	6 cut(s)	148, 155, 218, 227, 244, 314
AsuHPI	GGTGA	1 cut(s)	338
AsuNHI	GCTAGC	1 cut(s)	103
BarI	GAAGNNNNNNTAC	2 cut(s)	196, 228
BauI	CACGAG	1 cut(s)	108
Bbv12I	GWGCWC	1 cut(s)	16
BbvI	GCAGC	6 cut(s)	135, 167, 205, 214, 256, 301
BcoDI	GTCTC	1 cut(s)	68
BfaI	CTAG	1 cut(s)	104
BisI	GCNGC	7 cut(s)	62, 149, 156, 219, 228, 245, 315
BlsI	GCNGC	7 cut(s)	63, 150, 157, 220, 229, 246, 316
BmsI	GCATC	1 cut(s)	16
BmtI	GCTAGC	1 cut(s)	107
BsaJI	CCNNGG	1 cut(s)	222
Bse1I	ACTGG	1 cut(s)	282
BseDI	CCNNGG	1 cut(s)	222
BseMII	CTCAG	1 cut(s)	296
BseNI	ACTGG	1 cut(s)	282
BseXI	GCAGC	6 cut(s)	135, 167, 205, 214, 256, 301
BsiHKAI	GWGCWC	1 cut(s)	16
BsmAI	GTCTC	1 cut(s)	68
BsmI	GAATGC	1 cut(s)	63
Bsp1286I	GDGCHC	1 cut(s)	16
BspACI	CCGC	1 cut(s)	61
BspCNI	CTCAG	1 cut(s)	297
BspOI	GCTAGC	1 cut(s)	107
BsrI	ACTGG	1 cut(s)	282
BssECI	CCNNGG	1 cut(s)	222
BssSI	CACGAG	1 cut(s)	108
BssT1I	CCWWGG	1 cut(s)	222
Bst2BI	CACGAG	1 cut(s)	108
BstC8I	GCNNGC	2 cut(s)	105, 153
BstDEI	CTNAG	1 cut(s)	305
BstMAI	GTCTC	1 cut(s)	68
BstMWI	GCNNNNNNNGC	5 cut(s)	191, 218, 224, 227, 236
BstNSI	RCATGY	1 cut(s)	155
BstV1I	GCAGC	6 cut(s)	135, 167, 205, 214, 256, 301
BtsIMutI	CAGTG	1 cut(s)	275
Cac8I	GCNNGC	2 cut(s)	105, 153
CviAII	CATG	1 cut(s)	152
CviJI	RGCY	8 cut(s)	103, 148, 212, 218, 227, 268, 314, 338
CviKI_1	RGCY	8 cut(s)	103, 148, 212, 218, 227, 268, 314, 338
DdeI	CTNAG	1 cut(s)	305
Eco130I	CCWWGG	1 cut(s)	222
EcoT14I	CCWWGG	1 cut(s)	222
ErhI	CCWWGG	1 cut(s)	222
FaeI	CATG	1 cut(s)	155
FaiI	YATR	4 cut(s)	51, 153, 191, 206
FatI	CATG	1 cut(s)	151
Fnu4HI	GCNGC	7 cut(s)	62, 149, 156, 219, 228, 245, 315
Fsp4HI	GCNGC	7 cut(s)	62, 149, 156, 219, 228, 245, 315
FspBI	CTAG	1 cut(s)	104
GluI	GCNGC	7 cut(s)	62, 149, 156, 219, 228, 245, 315
Hin1II	CATG	1 cut(s)	155
HindIII	AAGCTT	1 cut(s)	210
HphI	GGTGA	1 cut(s)	338
Hpy188I	TCNGA	2 cut(s)	264, 306
Hpy188III	TCNNGA	2 cut(s)	96, 131
HpyAV	CCTTC	2 cut(s)	93, 278
HpyCH4IV	ACGT	1 cut(s)	46
HpyCH4V	TGCA	3 cut(s)	151, 155, 275
HpyF10VI	GCNNNNNNNGC	5 cut(s)	191, 218, 224, 227, 236
HpyF3I	CTNAG	1 cut(s)	305
HpySE526I	ACGT	1 cut(s)	46
Hsp92II	CATG	1 cut(s)	155
LmnI	GCTCC	1 cut(s)	19
LpnPI	CCDG	6 cut(s)	50, 65, 109, 144, 185, 263
Lsp1109I	GCAGC	6 cut(s)	135, 167, 205, 214, 256, 301
LweI	GCATC	1 cut(s)	16
MaeI	CTAG	1 cut(s)	104
MaeII	ACGT	1 cut(s)	46
MboII	GAAGA	1 cut(s)	35
MhlI	GDGCHC	1 cut(s)	16
MluCI	AATT	1 cut(s)	295
MmeI	TCCRAC	1 cut(s)	121
MnlI	CCTC	2 cut(s)	258, 322
MseI	TTAA	1 cut(s)	114
Mva1269I	GAATGC	1 cut(s)	63
MwoI	GCNNNNNNNGC	5 cut(s)	191, 218, 224, 227, 236
NheI	GCTAGC	1 cut(s)	103
NlaIII	CATG	1 cut(s)	155
NspI	RCATGY	1 cut(s)	155
PaeI	GCATGC	1 cut(s)	155
PcsI	WCGNNNNNNNCGW	1 cut(s)	52
PctI	GAATGC	1 cut(s)	63
PkrI	GCNGC	7 cut(s)	63, 150, 157, 220, 229, 246, 316
Psp1406I	AACGTT	1 cut(s)	46
SaqAI	TTAA	1 cut(s)	114
SatI	GCNGC	7 cut(s)	62, 149, 156, 219, 228, 245, 315
SduI	GDGCHC	1 cut(s)	16
SetI	ASST	5 cut(s)	49, 150, 214, 333, 340
SfaNI	GCATC	1 cut(s)	16
SphI	GCATGC	1 cut(s)	155
Sse9I	AATT	1 cut(s)	295
SsiI	CCGC	1 cut(s)	61
SspMI	CTAG	1 cut(s)	104
StyI	CCWWGG	1 cut(s)	222
TaiI	ACGT	1 cut(s)	49
TaqI	TCGA	1 cut(s)	55
TasI	AATT	1 cut(s)	295
TauI	GCSGC	1 cut(s)	64
Tru1I	TTAA	1 cut(s)	114
Tru9I	TTAA	1 cut(s)	114
TscAI	CASTG	1 cut(s)	282
TseI	GCWGC	6 cut(s)	148, 155, 218, 227, 244, 314
TspDTI	ATGAA	1 cut(s)	185
TspRI	CASTG	1 cut(s)	282
XceI	RCATGY	1 cut(s)	155
XspI	CTAG	1 cut(s)	104

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.