Rroxscaffold_3G00266630

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
59843592 .. 59847264
3673 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00266630.1

Sequence Viewer

Length: 156 bp
ATGATATCAGTTGGTCTTGGCAGTGCTATAAGCGAGGAGAGTGAGGCTGCTGTTAATGTACAGATCAAACCTAGACAGGCTATTGAAGTTTTCAAACACCAAGCAAAAGTGAGGGAAACATCAGGCAATACAGAGAGTGTTATGAAACAGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.54

Weight (kDa)

8.16

Isoelectric Point (pI)

37.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 60
AgsI TTSAA 2 cut(s) 86, 94
ApeKI GCWGC 1 cut(s) 47
BbvI GCAGC 1 cut(s) 34
BfaI CTAG 1 cut(s) 72
BisI GCNGC 1 cut(s) 48
BlsI GCNGC 1 cut(s) 49
BseRI GAGGAG 1 cut(s) 50
BseXI GCAGC 1 cut(s) 34
Bsp1407I TGTACA 1 cut(s) 58
Bsp143I GATC 1 cut(s) 63
BsrGI TGTACA 1 cut(s) 58
BssMI GATC 1 cut(s) 63
BstAUI TGTACA 1 cut(s) 58
BstKTI GATC 1 cut(s) 66
BstMBI GATC 1 cut(s) 63
BstV1I GCAGC 1 cut(s) 34
BtsI GCAGTG 1 cut(s) 28
BtsIMutI CAGTG 1 cut(s) 28
Csp6I GTAC 1 cut(s) 59
CviJI RGCY 2 cut(s) 47, 80
CviKI_1 RGCY 2 cut(s) 47, 80
CviQI GTAC 1 cut(s) 59
DpnI GATC 1 cut(s) 65
DpnII GATC 1 cut(s) 63
Eco32I GATATC 1 cut(s) 6
EcoRV GATATC 1 cut(s) 6
FaiI YATR 2 cut(s) 29, 143
Fnu4HI GCNGC 1 cut(s) 48
Fsp4HI GCNGC 1 cut(s) 48
FspBI CTAG 1 cut(s) 72
FspEI CC 9 cut(s) 3, 20, 29, 62, 84, 97, 98, 108, 113
GluI GCNGC 1 cut(s) 48
Kzo9I GATC 1 cut(s) 63
LpnPI CCDG 2 cut(s) 62, 108
Lsp1109I GCAGC 1 cut(s) 34
MaeI CTAG 1 cut(s) 72
MalI GATC 1 cut(s) 65
MboI GATC 1 cut(s) 63
MnlI CCTC 3 cut(s) 28, 37, 105
MseI TTAA 1 cut(s) 54
NdeII GATC 1 cut(s) 63
PkrI GCNGC 1 cut(s) 49
RsaI GTAC 1 cut(s) 60
RsaNI GTAC 1 cut(s) 59
SaqAI TTAA 1 cut(s) 54
SatI GCNGC 1 cut(s) 48
Sau3AI GATC 1 cut(s) 63
SetI ASST 1 cut(s) 73
SgeI CNNG 6 cut(s) 29, 46, 84, 89, 113, 135
SspMI CTAG 1 cut(s) 72
TatI WGTACW 1 cut(s) 58
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TscAI CASTG 1 cut(s) 28
TseI GCWGC 1 cut(s) 47
TspRI CASTG 1 cut(s) 28
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.