Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000027.1

Orthogroup ID

OG0003307

Physical Location & Seq

Genomic Coordinates Reverse (-)

29606 .. 31614

Gene Structure 2009 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000027.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1215 bp

atggaaaacttttcccgaccctccacaaccgttctccttcttctccgattccgatgcggaggaggagtaacgcctccattcgttacctaccgtttcaatttctctcctcctcctcagtccgataatttgttgcccaaatcaacttcgatttctccgatggccgtccaccctgggtgtcgttttccctcgtgcaagagcagaggagagagatggcttctagatgagattgcaatacggttgagagactctgatgagcaagtggcagctgttttaacagatgatggttttgatgaacaatatgaacatcatttggaactttttaaggatgaactagagatgttggaagatgaaatggtggaacttgaacaagaattgaaagaacttgaactgttggaggttgcaggagaaatggaacaacttgaaatgttggctattgaaggttcatatccctacttaaacaatggtgtgaaccctgaggcatttgcttatgataaggctggtgatggaaacaaagatatcattctctgggatgttgcacctctcacccttggtatcgaaactgctggtggtattatgactaaattgattcccagaaacactgtgatcccaaccaagaaatcccaggttttcaccacttatcaggatcagcagagtacagtctacattcaggtctatgggggtgaagggagtctaacaagatattgcaggatccttggaaaatttgaacttactggcattcccccagccccaaggggtattcctcggattgaagtcatgtttgaagtggataccaatggtatcctgaatgtcaaggcagaagacaagggcactggcaaatctgagaagatcaccatcaccaatgacaagggttgcacaagccaagaagaaattgagtgcatagtcaaagaggcagaggagttagctgatgaggaccagaaggtgaaggagaggattgatgcccataatagcctgaaaacttttatctacaacttgaagaaccagatcaacgaaatggacaagcttgagtatgatgagaaggataagcttgagaccactgtgaagaaggccctggaatggatgaaggacaaccagaccgctgagaagaggactatgaggagaagctcaaggaggttgaagcaatctgcaacgctatcatcacaactgtttaccagaggtcaggtgatactcctgtggattaattcaatagctgaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005788 GO:0012505 GO:0031974 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0044422 GO:0044424 GO:0044432 GO:0044444 GO:0044446 GO:0044464 GO:0070013

KEGG Pathways

Metabolic & Signaling

ko03060 ko04141 ko04918 ko05020 map03060 map04141 map04918 map05020

Pfam Domains

Protein Families

HSP70

Protein Analysis

404

Amino Acids

45.85

Weight (kDa)

4.88

Isoelectric Point (pI)

42.47

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003307)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G28540 AT5G42020 AT5G42020 AT5G42020
fragaria_vesca	FvH4_3g14480 FvH4_5g11500 FvH4_5g11500
malus_domestica	MD06G1113000.v1.1 MD14G1134100.v1.1
prunus_persica	Prupe.5G125900_v2.0.a1 Prupe.5G125900_v2.0.a1 Prupe.5G125900_v2.0.a1
pyrus_communis	pycom06g10560 pycom06g10570
rosa_chinensis	RchiOBHm_Chr5g0023851 RchiOBHm_Chr7g0186301
rosa_laevigata	RLG00000004851 RLG00000032740
rosa_multiflora	Rmu_co8308791.1_g000001 Rmu_sc0001372.1_g000006 Rmu_sc0018092.1_g000001 Rmu_ssc0000027.1_g000008
rosa_roxburghii	Rroxscaffold_1G00055390 Rroxscaffold_3G00268240
rosa_rugosa	Rorug05G0079800 Rorug06G0473100
rosa_samantha	Rh5AG169800 Rh5BG167100 Rh5CG182700 Rh5DG169200 Rh7AG067900 Rh7BG083700 Rh7CG080100 Rh7DG080700
rosa_wichuraiana	Rw5G015350 Rw7G006710

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	660
AciI	CCGC	2 cut(s)	57, 1095
AclWI	GGATC	4 cut(s)	598, 651, 703, 716
AcoI	YGGCCR	1 cut(s)	159
AcsI	RAATTY	1 cut(s)	719
AfaI	GTAC	1 cut(s)	655
AfiI	CCNNNNNNNGG	1 cut(s)	1074
AjnI	CCWGG	3 cut(s)	169, 621, 1068
AluBI	AGCT	6 cut(s)	266, 923, 1021, 1045, 1122, 1208
AluI	AGCT	6 cut(s)	266, 923, 1021, 1045, 1122, 1208
Alw26I	GTCTC	2 cut(s)	237, 1043
AlwI	GGATC	4 cut(s)	598, 651, 703, 716
AoxI	GGCC	2 cut(s)	159, 1065
ApeKI	GCWGC	1 cut(s)	263
ApoI	RAATTY	1 cut(s)	719
AseI	ATTAAT	1 cut(s)	1197
AspS9I	GGNCC	2 cut(s)	931, 1066
AsuHPI	GGTGA	8 cut(s)	512, 535, 622, 692, 841, 847, 952, 1192
AvaII	GGWCC	1 cut(s)	931
AxyI	CCTNAGG	1 cut(s)	474
BaeGI	GKGCMC	1 cut(s)	830
BaeI	ACNNNNGTAYC	2 cut(s)	1175, 1208
BamHI	GGATCC	1 cut(s)	708
BauI	CACGAG	1 cut(s)	187
BbsI	GAAGAC	1 cut(s)	825
BbvI	GCAGC	1 cut(s)	275
BccI	CCATC	5 cut(s)	151, 204, 275, 497, 860
BceAI	ACGGC	1 cut(s)	146
BcgI	CGANNNNNNTGC	2 cut(s)	36, 70
BciT130I	CCWGG	3 cut(s)	171, 623, 1070
BciVI	GTATCC	2 cut(s)	781, 809
BcoDI	GTCTC	2 cut(s)	237, 1043
BfaI	CTAG	2 cut(s)	218, 332
BfuI	GTATCC	2 cut(s)	781, 809
BisI	GCNGC	1 cut(s)	264
BlsI	GCNGC	1 cut(s)	265
Bme1390I	CCNGG	3 cut(s)	171, 623, 1070
Bme18I	GGWCC	1 cut(s)	931
BmgT120I	GGNCC	2 cut(s)	931, 1066
BmiI	GGNNCC	1 cut(s)	710
BmrFI	CCNGG	3 cut(s)	171, 623, 1070
BmsI	GCATC	2 cut(s)	44, 946
BpiI	GAAGAC	1 cut(s)	825
BpuEI	CTTGAG	3 cut(s)	1043, 1067, 1108
BsaBI	GATNNNNATC	1 cut(s)	851
BsaI	GGTCTC	1 cut(s)	1043
BsaJI	CCNNGG	8 cut(s)	169, 170, 547, 621, 712, 749, 761, 1068
BsaXI	ACNNNNNCTCC	2 cut(s)	51, 81
Bsc4I	CCNNNNNNNGG	1 cut(s)	1074
Bse1I	ACTGG	2 cut(s)	736, 835
Bse21I	CCTNAGG	1 cut(s)	474
Bse8I	GATNNNNATC	1 cut(s)	851
BseBI	CCWGG	3 cut(s)	171, 623, 1070
BseDI	CCNNGG	8 cut(s)	169, 170, 547, 621, 712, 749, 761, 1068
BseGI	GGATG	3 cut(s)	331, 535, 1083
BseJI	GATNNNNATC	1 cut(s)	851
BseLI	CCNNNNNNNGG	1 cut(s)	1074
BseMII	CTCAG	4 cut(s)	128, 465, 831, 1089
BseNI	ACTGG	2 cut(s)	736, 835
BseRI	GAGGAG	8 cut(s)	75, 78, 96, 99, 102, 216, 929, 1129
BseSI	GKGCMC	1 cut(s)	830
BseXI	GCAGC	1 cut(s)	275
BseYI	CCCAGC	1 cut(s)	742
BshFI	GGCC	2 cut(s)	161, 1067
BslI	CCNNNNNNNGG	1 cut(s)	1074
BsmAI	GTCTC	2 cut(s)	237, 1043
BsmI	GAATGC	1 cut(s)	735
BsnI	GGCC	2 cut(s)	161, 1067
Bso31I	GGTCTC	1 cut(s)	1043
Bsp1286I	GDGCHC	1 cut(s)	830
Bsp143I	GATC	5 cut(s)	603, 643, 708, 846, 1002
BspACI	CCGC	2 cut(s)	57, 1095
BspANI	GGCC	2 cut(s)	161, 1067
BspCNI	CTCAG	4 cut(s)	127, 466, 832, 1090
BspLI	GGNNCC	1 cut(s)	710
BspPI	GGATC	4 cut(s)	598, 651, 703, 716
BspTNI	GGTCTC	1 cut(s)	1043
BsrI	ACTGG	2 cut(s)	736, 835
BssECI	CCNNGG	8 cut(s)	169, 170, 547, 621, 712, 749, 761, 1068
BssMI	GATC	5 cut(s)	603, 643, 708, 846, 1002
BssSI	CACGAG	1 cut(s)	187
BssT1I	CCWWGG	3 cut(s)	547, 712, 749
Bst2BI	CACGAG	1 cut(s)	187
Bst2UI	CCWGG	3 cut(s)	171, 623, 1070
Bst4CI	ACNGT	8 cut(s)	31, 92, 237, 390, 601, 658, 1057, 1164
Bst6I	CTCTTC	1 cut(s)	1097
BstDEI	CTNAG	4 cut(s)	114, 474, 840, 1098
BstF5I	GGATG	3 cut(s)	331, 535, 1083
BstKTI	GATC	5 cut(s)	606, 646, 711, 849, 1005
BstMAI	GTCTC	2 cut(s)	237, 1043
BstMBI	GATC	5 cut(s)	603, 643, 708, 846, 1002
BstNI	CCWGG	3 cut(s)	171, 623, 1070
BstSCI	CCNGG	3 cut(s)	169, 621, 1068
BstSLI	GKGCMC	1 cut(s)	830
BstV1I	GCAGC	1 cut(s)	275
BstV2I	GAAGAC	1 cut(s)	825
BstX2I	RGATCY	1 cut(s)	708
BstYI	RGATCY	1 cut(s)	708
Bsu36I	CCTNAGG	1 cut(s)	474
BsuI	GTATCC	2 cut(s)	781, 809
BsuRI	GGCC	2 cut(s)	161, 1067
BtsCI	GGATG	3 cut(s)	331, 535, 1083
BtsIMutI	CAGTG	3 cut(s)	597, 828, 1053
Cfr13I	GGNCC	2 cut(s)	931, 1066
Csp6I	GTAC	1 cut(s)	654
CviAII	CATG	1 cut(s)	775
CviQI	GTAC	1 cut(s)	654
DdeI	CTNAG	4 cut(s)	114, 474, 840, 1098
DpnI	GATC	5 cut(s)	605, 645, 710, 848, 1004
DpnII	GATC	5 cut(s)	603, 643, 708, 846, 1002
EaeI	YGGCCR	1 cut(s)	159
Eam1104I	CTCTTC	1 cut(s)	1097
EarI	CTCTTC	1 cut(s)	1097
Eco130I	CCWWGG	3 cut(s)	547, 712, 749
Eco31I	GGTCTC	1 cut(s)	1043
Eco32I	GATATC	1 cut(s)	517
Eco47I	GGWCC	1 cut(s)	931
Eco81I	CCTNAGG	1 cut(s)	474
EcoO109I	RGGNCCY	1 cut(s)	1066
EcoRII	CCWGG	3 cut(s)	169, 621, 1068
EcoRV	GATATC	1 cut(s)	517
EcoT14I	CCWWGG	3 cut(s)	547, 712, 749
ErhI	CCWWGG	3 cut(s)	547, 712, 749
FaeI	CATG	1 cut(s)	778
FatI	CATG	1 cut(s)	774
FblI	GTMKAC	1 cut(s)	660
Fnu4HI	GCNGC	1 cut(s)	264
FokI	GGATG	3 cut(s)	338, 542, 1090
Fsp4HI	GCNGC	1 cut(s)	264
FspBI	CTAG	2 cut(s)	218, 332
GluI	GCNGC	1 cut(s)	264
GsaI	CCCAGC	1 cut(s)	746
HaeIII	GGCC	2 cut(s)	161, 1067
Hin1II	CATG	1 cut(s)	778
HindIII	AAGCTT	2 cut(s)	1019, 1043
HinfI	GANTC	4 cut(s)	48, 245, 586, 688
HphI	GGTGA	8 cut(s)	512, 535, 622, 692, 841, 847, 952, 1192
Hpy166II	GTNNAC	4 cut(s)	166, 469, 661, 1167
Hpy188I	TCNGA	7 cut(s)	47, 53, 121, 156, 250, 765, 841
Hpy188III	TCNNGA	4 cut(s)	15, 218, 641, 802
Hpy8I	GTNNAC	4 cut(s)	166, 469, 661, 1167
HpyAV	CCTTC	8 cut(s)	47, 431, 677, 931, 937, 1030, 1057, 1075
HpyCH4III	ACNGT	8 cut(s)	31, 92, 237, 390, 601, 658, 1057, 1164
HpyCH4V	TGCA	8 cut(s)	192, 230, 401, 536, 705, 873, 897, 1145
HpyF3I	CTNAG	4 cut(s)	114, 474, 840, 1098
Hsp92II	CATG	1 cut(s)	778
Kzo9I	GATC	5 cut(s)	603, 643, 708, 846, 1002
Lsp1109I	GCAGC	1 cut(s)	275
LweI	GCATC	2 cut(s)	44, 946
MaeI	CTAG	2 cut(s)	218, 332
MaeIII	GTNAC	2 cut(s)	67, 82
MalI	GATC	5 cut(s)	605, 645, 710, 848, 1004
MboI	GATC	5 cut(s)	603, 643, 708, 846, 1002
MboII	GAAGA	8 cut(s)	32, 356, 830, 856, 896, 1006, 1072, 1114
MflI	RGATCY	1 cut(s)	708
MhlI	GDGCHC	1 cut(s)	830
MluCI	AATT	7 cut(s)	97, 124, 371, 581, 719, 888, 1198
MlyI	GAGTC	2 cut(s)	239, 697
MmeI	TCCRAC	2 cut(s)	321, 372
MseI	TTAA	4 cut(s)	272, 321, 455, 1197
MspA1I	CMGCKG	2 cut(s)	266, 1097
MspR9I	CCNGG	3 cut(s)	171, 623, 1070
Mva1269I	GAATGC	1 cut(s)	735
MvaI	CCWGG	3 cut(s)	171, 623, 1070
NdeII	GATC	5 cut(s)	603, 643, 708, 846, 1002
NlaIII	CATG	1 cut(s)	778
NlaIV	GGNNCC	1 cut(s)	710
PasI	CCCWGGG	1 cut(s)	170
PcsI	WCGNNNNNNNCGW	1 cut(s)	152
PctI	GAATGC	1 cut(s)	735
PfeI	GAWTC	2 cut(s)	48, 586
PkrI	GCNGC	1 cut(s)	265
PleI	GAGTC	2 cut(s)	239, 696
PpsI	GAGTC	2 cut(s)	239, 696
PshBI	ATTAAT	1 cut(s)	1197
Psp6I	CCWGG	3 cut(s)	169, 621, 1068
PspFI	CCCAGC	1 cut(s)	742
PspGI	CCWGG	3 cut(s)	169, 621, 1068
PspN4I	GGNNCC	1 cut(s)	710
PspPI	GGNCC	2 cut(s)	931, 1066
PsuI	RGATCY	1 cut(s)	708
PvuII	CAGCTG	1 cut(s)	266
RsaI	GTAC	1 cut(s)	655
RsaNI	GTAC	1 cut(s)	654
SaqAI	TTAA	4 cut(s)	272, 321, 455, 1197
SatI	GCNGC	1 cut(s)	264
Sau3AI	GATC	5 cut(s)	603, 643, 708, 846, 1002
Sau96I	GGNCC	2 cut(s)	931, 1066
SchI	GAGTC	2 cut(s)	239, 697
ScrFI	CCNGG	3 cut(s)	171, 623, 1070
SduI	GDGCHC	1 cut(s)	830
SfaNI	GCATC	2 cut(s)	44, 946
SinI	GGWCC	1 cut(s)	931
SmlI	CTYRAG	3 cut(s)	1022, 1046, 1123
SmoI	CTYRAG	3 cut(s)	1022, 1046, 1123
Sse9I	AATT	7 cut(s)	97, 124, 371, 581, 719, 888, 1198
SsiI	CCGC	2 cut(s)	57, 1095
SspMI	CTAG	2 cut(s)	218, 332
StyD4I	CCNGG	3 cut(s)	169, 621, 1068
StyI	CCWWGG	3 cut(s)	547, 712, 749
TaaI	ACNGT	8 cut(s)	31, 92, 237, 390, 601, 658, 1057, 1164
TaqI	TCGA	2 cut(s)	146, 555
TasI	AATT	7 cut(s)	97, 124, 371, 581, 719, 888, 1198
TatI	WGTACW	1 cut(s)	653
TfiI	GAWTC	2 cut(s)	48, 586
Tru1I	TTAA	4 cut(s)	272, 321, 455, 1197
Tru9I	TTAA	4 cut(s)	272, 321, 455, 1197
TscAI	CASTG	3 cut(s)	604, 835, 1060
TseI	GCWGC	1 cut(s)	263
TspDTI	ATGAA	6 cut(s)	306, 315, 342, 363, 432, 1094
TspRI	CASTG	3 cut(s)	604, 835, 1060
VpaK11BI	GGWCC	1 cut(s)	931
VspI	ATTAAT	1 cut(s)	1197
XapI	RAATTY	1 cut(s)	719
XbaI	TCTAGA	1 cut(s)	217
XmiI	GTMKAC	1 cut(s)	660
XspI	CTAG	2 cut(s)	218, 332

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.