Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000001

Orthogroup ID

OG0010617

Physical Location & Seq

Genomic Coordinates Forward (+)

3410408 .. 3417260

Gene Structure 6853 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_1G00002870.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 519 bp

ATGTCCACAAGTCATAGTCGAGTCAACAGAACCAAGGTGTCCAAACAAAGAATTTCCAATCCAGTTGCCTTTGTGAATCACAAATTATCATTCAAAAATGATGCTCGTAACATCAATCACTCACCAATCCCGGTTGAGCGGGTCAGCTGCCACGTCAATGCGAAACACTCCTGGAGACGAGTGACTCATCACTACAATATTGGTGCCCGCAATTGCATGACGAGTAGCAGTGACCACGCTTTGACGTCATCCGAGACCTGCAAGCGAAGCCCGGACCCAATTCCGGCGTGGAACTTTGTTGCTTCCGGACATCCGACAAACAAAATTAGCGAAGCCCGGACCCGATTCGGGCTTAGAGCTTCGGAGCTTCCCGACATCCGACGAACAAAACCGGCGAAGCCCGGAAGGGTTGGGATCATGGAGTTGGATGTCGTCATCCTCTCGGTAGTCCGACGGTGGGACGGAGCGGCGGCGGTGGAGGCCGACATCGACGGTGGAGTGGTGGGCGTGGTGGCTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

172

Amino Acids

18.96

Weight (kDa)

10.5

Isoelectric Point (pI)

61.09

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010617)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0341591 RchiOBHm_Chr4g0439251 RchiOBHm_Chr6g0299511 RchiOBHm_Chr7g0195341
rosa_laevigata	RLG00000027966
rosa_multiflora	Rmu_co8079744.1_g000001 Rmu_sc0000007.1_g000018 Rmu_sc0006244.1_g000056
rosa_roxburghii	Rroxscaffold_1G00002870 Rroxscaffold_1G00012660 Rroxscaffold_1G00025380 Rroxscaffold_2G00077540 Rroxscaffold_2G00091390 Rroxscaffold_3G00222820 Rroxscaffold_3G00250020 Rroxscaffold_3G00264890 Rroxscaffold_5G00383440
rosa_samantha	Rh2CG071700 Rh3CG292600 Rh5AG323700 Rh7CG155000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	248
Acc36I	ACCTGC	1 cut(s)	266
AccB1I	GGYRCC	1 cut(s)	203
AccBSI	CCGCTC	2 cut(s)	139, 467
AccIII	TCCGGA	1 cut(s)	305
AciI	CCGC	5 cut(s)	139, 208, 467, 470, 473
AclWI	GGATC	1 cut(s)	422
AcsI	RAATTY	1 cut(s)	51
AcyI	GRCGYC	1 cut(s)	245
AfiI	CCNNNNNNNGG	3 cut(s)	283, 348, 457
AgsI	TTSAA	1 cut(s)	94
AjiI	CACGTC	1 cut(s)	154
AjnI	CCWGG	1 cut(s)	170
AluBI	AGCT	3 cut(s)	147, 359, 367
AluI	AGCT	3 cut(s)	147, 359, 367
Alw26I	GTCTC	2 cut(s)	169, 248
AlwI	GGATC	1 cut(s)	422
Aor13HI	TCCGGA	1 cut(s)	305
AoxI	GGCC	1 cut(s)	480
ApeKI	GCWGC	1 cut(s)	147
ApoI	RAATTY	1 cut(s)	51
AspS9I	GGNCC	2 cut(s)	274, 339
AsuC2I	CCSGG	4 cut(s)	131, 272, 337, 402
AsuHPI	GGTGA	1 cut(s)	114
AvaII	GGWCC	2 cut(s)	274, 339
BaeGI	GKGCMC	1 cut(s)	208
BanI	GGYRCC	1 cut(s)	203
BbvI	GCAGC	1 cut(s)	134
BciT130I	CCWGG	1 cut(s)	172
BcnI	CCSGG	4 cut(s)	131, 272, 337, 402
BcoDI	GTCTC	2 cut(s)	169, 248
BfuAI	ACCTGC	1 cut(s)	266
BisI	GCNGC	3 cut(s)	148, 468, 471
BlsI	GCNGC	3 cut(s)	149, 469, 472
Bme1390I	CCNGG	5 cut(s)	131, 172, 272, 337, 402
Bme18I	GGWCC	2 cut(s)	274, 339
BmgBI	CACGTC	1 cut(s)	154
BmgT120I	GGNCC	2 cut(s)	274, 339
BmiI	GGNNCC	3 cut(s)	205, 276, 341
BmrFI	CCNGG	5 cut(s)	131, 172, 272, 337, 402
BmsI	GCATC	1 cut(s)	91
BpmI	CTGGAG	1 cut(s)	193
BpuMI	CCSGG	4 cut(s)	131, 272, 337, 402
BsaHI	GRCGYC	1 cut(s)	245
BsaI	GGTCTC	1 cut(s)	248
BsaJI	CCNNGG	1 cut(s)	33
BsaWI	WCCGGW	1 cut(s)	305
Bsc4I	CCNNNNNNNGG	3 cut(s)	283, 348, 457
Bse118I	RCCGGY	1 cut(s)	391
Bse1I	ACTGG	1 cut(s)	62
BseAI	TCCGGA	1 cut(s)	305
BseBI	CCWGG	1 cut(s)	172
BseDI	CCNNGG	1 cut(s)	33
BseGI	GGATG	5 cut(s)	248, 310, 375, 433, 435
BseLI	CCNNNNNNNGG	3 cut(s)	283, 348, 457
BseNI	ACTGG	1 cut(s)	62
BseSI	GKGCMC	1 cut(s)	208
BseXI	GCAGC	1 cut(s)	134
BshFI	GGCC	1 cut(s)	482
BshNI	GGYRCC	1 cut(s)	203
BsiSI	CCGG	7 cut(s)	131, 272, 284, 306, 337, 392, 402
BslFI	GGGAC	1 cut(s)	473
BslI	CCNNNNNNNGG	3 cut(s)	283, 348, 457
BsmAI	GTCTC	2 cut(s)	169, 248
BsmBI	CGTCTC	1 cut(s)	169
BsmFI	GGGAC	1 cut(s)	473
BsnI	GGCC	1 cut(s)	482
Bso31I	GGTCTC	1 cut(s)	248
Bsp1286I	GDGCHC	1 cut(s)	208
Bsp13I	TCCGGA	1 cut(s)	305
Bsp143I	GATC	1 cut(s)	414
BspACI	CCGC	5 cut(s)	139, 208, 467, 470, 473
BspANI	GGCC	1 cut(s)	482
BspEI	TCCGGA	1 cut(s)	305
BspLI	GGNNCC	3 cut(s)	205, 276, 341
BspMI	ACCTGC	1 cut(s)	266
BspPI	GGATC	1 cut(s)	422
BspT107I	GGYRCC	1 cut(s)	203
BspTNI	GGTCTC	1 cut(s)	248
BsrBI	CCGCTC	2 cut(s)	139, 467
BsrFI	RCCGGY	1 cut(s)	391
BsrI	ACTGG	1 cut(s)	62
BssAI	RCCGGY	1 cut(s)	391
BssECI	CCNNGG	1 cut(s)	33
BssMI	GATC	1 cut(s)	414
BssNI	GRCGYC	1 cut(s)	245
BssT1I	CCWWGG	1 cut(s)	33
Bst2UI	CCWGG	1 cut(s)	172
Bst4CI	ACNGT	2 cut(s)	456, 494
BstACI	GRCGYC	1 cut(s)	245
BstC8I	GCNNGC	2 cut(s)	208, 263
BstDEI	CTNAG	2 cut(s)	353, 516
BstF5I	GGATG	5 cut(s)	248, 310, 375, 433, 435
BstKTI	GATC	1 cut(s)	417
BstMAI	GTCTC	2 cut(s)	169, 248
BstMBI	GATC	1 cut(s)	414
BstMWI	GCNNNNNNNGC	2 cut(s)	267, 479
BstNI	CCWGG	1 cut(s)	172
BstSCI	CCNGG	5 cut(s)	129, 170, 270, 335, 400
BstSLI	GKGCMC	1 cut(s)	208
BstV1I	GCAGC	1 cut(s)	134
BsuRI	GGCC	1 cut(s)	482
BtrI	CACGTC	1 cut(s)	154
BtsCI	GGATG	5 cut(s)	248, 310, 375, 433, 435
BtsI	GCAGTG	1 cut(s)	235
BtsIMutI	CAGTG	1 cut(s)	235
BveI	ACCTGC	1 cut(s)	266
Cac8I	GCNNGC	2 cut(s)	208, 263
Cfr10I	RCCGGY	1 cut(s)	391
Cfr13I	GGNCC	2 cut(s)	274, 339
CviAII	CATG	2 cut(s)	217, 418
CviJI	RGCY	9 cut(s)	147, 270, 335, 352, 359, 367, 400, 482, 515
CviKI_1	RGCY	9 cut(s)	147, 270, 335, 352, 359, 367, 400, 482, 515
DdeI	CTNAG	2 cut(s)	353, 516
DpnI	GATC	1 cut(s)	416
DpnII	GATC	1 cut(s)	414
Eco130I	CCWWGG	1 cut(s)	33
Eco31I	GGTCTC	1 cut(s)	248
Eco47I	GGWCC	2 cut(s)	274, 339
EcoRII	CCWGG	1 cut(s)	170
EcoT14I	CCWWGG	1 cut(s)	33
ErhI	CCWWGG	1 cut(s)	33
Esp3I	CGTCTC	1 cut(s)	169
FaeI	CATG	2 cut(s)	220, 421
FaiI	YATR	3 cut(s)	15, 218, 419
FaqI	GGGAC	1 cut(s)	473
FatI	CATG	2 cut(s)	216, 417
FauI	CCCGC	2 cut(s)	132, 215
Fnu4HI	GCNGC	3 cut(s)	148, 468, 471
FokI	GGATG	5 cut(s)	235, 297, 362, 422, 440
Fsp4HI	GCNGC	3 cut(s)	148, 468, 471
GluI	GCNGC	3 cut(s)	148, 468, 471
GsuI	CTGGAG	1 cut(s)	193
HaeIII	GGCC	1 cut(s)	482
HapII	CCGG	7 cut(s)	131, 272, 284, 306, 337, 392, 402
Hin1I	GRCGYC	1 cut(s)	245
Hin1II	CATG	2 cut(s)	220, 421
HincII	GTYRAC	1 cut(s)	25
HindII	GTYRAC	1 cut(s)	25
HinfI	GANTC	4 cut(s)	21, 76, 184, 345
HpaII	CCGG	7 cut(s)	131, 272, 284, 306, 337, 392, 402
HphI	GGTGA	1 cut(s)	114
Hpy166II	GTNNAC	2 cut(s)	6, 25
Hpy188I	TCNGA	5 cut(s)	253, 315, 364, 380, 452
Hpy188III	TCNNGA	2 cut(s)	306, 371
Hpy8I	GTNNAC	2 cut(s)	6, 25
Hpy99I	CGWCG	3 cut(s)	384, 456, 494
HpyAV	CCTTC	1 cut(s)	399
HpyCH4III	ACNGT	2 cut(s)	456, 494
HpyCH4IV	ACGT	2 cut(s)	153, 245
HpyCH4V	TGCA	2 cut(s)	216, 261
HpyF10VI	GCNNNNNNNGC	2 cut(s)	267, 479
HpyF3I	CTNAG	2 cut(s)	353, 516
HpySE526I	ACGT	2 cut(s)	153, 245
Hsp92I	GRCGYC	1 cut(s)	245
Hsp92II	CATG	2 cut(s)	220, 421
Kpn2I	TCCGGA	1 cut(s)	305
Kzo9I	GATC	1 cut(s)	414
LmnI	GCTCC	2 cut(s)	364, 464
Lsp1109I	GCAGC	1 cut(s)	134
LweI	GCATC	1 cut(s)	91
MaeII	ACGT	2 cut(s)	153, 245
MaeIII	GTNAC	3 cut(s)	107, 181, 230
MalI	GATC	1 cut(s)	416
MbiI	CCGCTC	2 cut(s)	139, 467
MboI	GATC	1 cut(s)	414
MfeI	CAATTG	1 cut(s)	211
MhlI	GDGCHC	1 cut(s)	208
MluCI	AATT	5 cut(s)	51, 83, 211, 279, 324
MlyI	GAGTC	2 cut(s)	30, 178
MmeI	TCCRAC	4 cut(s)	338, 403, 405, 475
MnlI	CCTC	2 cut(s)	449, 472
MroI	TCCGGA	1 cut(s)	305
MslI	CAYNNNNRTG	1 cut(s)	156
MspA1I	CMGCKG	1 cut(s)	147
MspI	CCGG	7 cut(s)	131, 272, 284, 306, 337, 392, 402
MspR9I	CCNGG	5 cut(s)	131, 172, 272, 337, 402
MunI	CAATTG	1 cut(s)	211
MvaI	CCWGG	1 cut(s)	172
MwoI	GCNNNNNNNGC	2 cut(s)	267, 479
NciI	CCSGG	4 cut(s)	131, 272, 337, 402
NdeII	GATC	1 cut(s)	414
NlaIII	CATG	2 cut(s)	220, 421
NlaIV	GGNNCC	3 cut(s)	205, 276, 341
NmuCI	GTSAC	2 cut(s)	181, 230
PfeI	GAWTC	2 cut(s)	76, 345
PfoI	TCCNGGA	1 cut(s)	170
PkrI	GCNGC	3 cut(s)	149, 469, 472
PleI	GAGTC	2 cut(s)	29, 178
PpsI	GAGTC	2 cut(s)	29, 178
Psp6I	CCWGG	1 cut(s)	170
PspGI	CCWGG	1 cut(s)	170
PspN4I	GGNNCC	3 cut(s)	205, 276, 341
PspPI	GGNCC	2 cut(s)	274, 339
PvuII	CAGCTG	1 cut(s)	147
RseI	CAYNNNNRTG	1 cut(s)	156
SatI	GCNGC	3 cut(s)	148, 468, 471
Sau3AI	GATC	1 cut(s)	414
Sau96I	GGNCC	2 cut(s)	274, 339
SchI	GAGTC	2 cut(s)	30, 178
ScrFI	CCNGG	5 cut(s)	131, 172, 272, 337, 402
SduI	GDGCHC	1 cut(s)	208
SetI	ASST	7 cut(s)	39, 149, 156, 248, 260, 361, 369
SfaNI	GCATC	1 cut(s)	91
SinI	GGWCC	2 cut(s)	274, 339
SmiMI	CAYNNNNRTG	1 cut(s)	156
Sse9I	AATT	5 cut(s)	51, 83, 211, 279, 324
SsiI	CCGC	5 cut(s)	139, 208, 467, 470, 473
SspI	AATATT	1 cut(s)	199
StyD4I	CCNGG	5 cut(s)	129, 170, 270, 335, 400
StyI	CCWWGG	1 cut(s)	33
TaaI	ACNGT	2 cut(s)	456, 494
TaiI	ACGT	2 cut(s)	156, 248
TaqI	TCGA	2 cut(s)	19, 489
TasI	AATT	5 cut(s)	51, 83, 211, 279, 324
TauI	GCSGC	2 cut(s)	470, 473
TfiI	GAWTC	2 cut(s)	76, 345
TscAI	CASTG	1 cut(s)	235
TseFI	GTSAC	2 cut(s)	181, 230
TseI	GCWGC	1 cut(s)	147
Tsp45I	GTSAC	2 cut(s)	181, 230
TspGWI	ACGGA	1 cut(s)	477
TspRI	CASTG	1 cut(s)	235
VpaK11BI	GGWCC	2 cut(s)	274, 339
XapI	RAATTY	1 cut(s)	51
XcmI	CCANNNNNNNNNTGG	1 cut(s)	285
ZraI	GACGTC	1 cut(s)	246

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.