Rroxscaffold_1G00043340

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
61804855 .. 61811484
6630 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00043340.1

Sequence Viewer

Length: 195 bp
ATGGATCCATCTATCTCGCTTTCGGGTACTAAAGCTTGGGCTACTTTTGATTGCGAAGACAGTTCCATTTTGTTGATCAACCAAGAAGCTTCTCCCATTTCTAGAGGGGCAGAGAAGAAGTTAGACAAGGAACTTTCAGTGCTTGAATGGGGTTCAAAGACTTGTCAAGTTGAAGTTATCACGAAAGTAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

6.98

Weight (kDa)

4.69

Isoelectric Point (pI)

23.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 12
AfaI GTAC 1 cut(s) 28
AgsI TTSAA 3 cut(s) 146, 156, 173
AluBI AGCT 2 cut(s) 35, 89
AluI AGCT 2 cut(s) 35, 89
AlwI GGATC 1 cut(s) 12
BamHI GGATCC 1 cut(s) 4
BbsI GAAGAC 1 cut(s) 63
BccI CCATC 1 cut(s) 16
BclI TGATCA 1 cut(s) 75
BfaI CTAG 1 cut(s) 102
BmiI GGNNCC 1 cut(s) 6
BpiI GAAGAC 1 cut(s) 63
Bsp143I GATC 2 cut(s) 4, 75
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 12
BssMI GATC 2 cut(s) 4, 75
Bst4CI ACNGT 1 cut(s) 62
BstKTI GATC 2 cut(s) 7, 78
BstMBI GATC 2 cut(s) 4, 75
BstV2I GAAGAC 1 cut(s) 63
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BtsIMutI CAGTG 1 cut(s) 144
Csp6I GTAC 1 cut(s) 27
CviJI RGCY 3 cut(s) 35, 41, 89
CviKI_1 RGCY 3 cut(s) 35, 41, 89
CviQI GTAC 1 cut(s) 27
DpnI GATC 2 cut(s) 6, 77
DpnII GATC 2 cut(s) 4, 75
FbaI TGATCA 1 cut(s) 75
FspBI CTAG 1 cut(s) 102
HindIII AAGCTT 2 cut(s) 33, 87
Hpy188III TCNNGA 2 cut(s) 102, 181
HpyCH4III ACNGT 1 cut(s) 62
Ksp22I TGATCA 1 cut(s) 75
Kzo9I GATC 2 cut(s) 4, 75
MaeI CTAG 1 cut(s) 102
MalI GATC 2 cut(s) 6, 77
MboI GATC 2 cut(s) 4, 75
MboII GAAGA 2 cut(s) 68, 127
MflI RGATCY 1 cut(s) 4
MnlI CCTC 1 cut(s) 98
NdeII GATC 2 cut(s) 4, 75
NlaIV GGNNCC 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 6
PsuI RGATCY 1 cut(s) 4
RsaI GTAC 1 cut(s) 28
RsaNI GTAC 1 cut(s) 27
Sau3AI GATC 2 cut(s) 4, 75
SetI ASST 2 cut(s) 37, 91
SgeI CNNG 9 cut(s) 28, 36, 48, 95, 114, 139, 155, 174, 179
SspMI CTAG 1 cut(s) 102
TaaI ACNGT 1 cut(s) 62
TscAI CASTG 1 cut(s) 144
TspRI CASTG 1 cut(s) 144
XbaI TCTAGA 1 cut(s) 101
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.