Rroxscaffold_1G00065300

Domain of unknown function (DUF3475)

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
87012423 .. 87013032
610 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00065300.1

Sequence Viewer

Length: 594 bp
ATGGTGAACCTAGCAAAATCTGTGGCTCGGCTTGGGAAGAAACATTGTACTGATCCTAGTTTGAAGGGTTTTGAATATGCAATTAGTGATTTGATCTATAATGGTGTTGACCCTTATGGATGGGAGTTTTCATTGAAGATGATGAAAATAAAGGCCAAGAGGATGCAGAAATTTATTTCAGTAAATGAAGATTTGCGTGACGAGATGAAAGTTCTTTCGGATCTTGAACAGACCTTGGAAGTCATCACTACCAACTTAGATGGTGAAATTTTGCTCGACTTTCAGCAGAAGGTAGAGTGGAAGAGGCAGGAGAGATCTCTATGTGGAACAACACTTAATGATGATGTGGTACTTCTTTTGGCAAGATCTCTCTTCACAACATTCGGTAGGATCAAGAAACTTGAGAAAGATTCTGATCACATTAGTCGTCGTTGTCATTCAGTTTCTTCAGTCCATCCATCTGAGGAAGGCCCAATTGCTGCAATGAAGAGAACCATCAGGAAGGTGTGGAAGTCTAATAGTTTGAGTGAAGTTGGACCTTTCAGAAATTCACCTGTCACCAATTGCTACTTGATCGAGATGGAACACCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

197

Amino Acids

22.65

Weight (kDa)

8.61

Isoelectric Point (pI)

43.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 47, 228, 398
AcsI RAATTY 3 cut(s) 170, 267, 547
AcuI CTGAAG 1 cut(s) 432
AfaI GTAC 2 cut(s) 49, 351
AgsI TTSAA 4 cut(s) 64, 74, 136, 227
AlwI GGATC 3 cut(s) 47, 228, 398
AoxI GGCC 2 cut(s) 153, 469
ApeKI GCWGC 1 cut(s) 479
ApoI RAATTY 3 cut(s) 170, 267, 547
AspS9I GGNCC 2 cut(s) 470, 536
AsuHPI GGTGA 4 cut(s) 16, 275, 543, 550
AvaII GGWCC 1 cut(s) 536
BbvI GCAGC 1 cut(s) 466
BccI CCATC 6 cut(s) 114, 254, 462, 466, 503, 574
BclI TGATCA 1 cut(s) 415
BfaI CTAG 2 cut(s) 11, 57
BglII AGATCT 2 cut(s) 314, 365
BisI GCNGC 1 cut(s) 480
BlsI GCNGC 1 cut(s) 481
Bme18I GGWCC 1 cut(s) 536
BmgT120I GGNCC 2 cut(s) 470, 536
BmsI GCATC 1 cut(s) 153
BpuEI CTTGAG 1 cut(s) 422
BsaBI GATNNNNATC 1 cut(s) 414
BsaJI CCNNGG 1 cut(s) 234
Bse3DI GCAATG 1 cut(s) 489
Bse8I GATNNNNATC 1 cut(s) 414
BseDI CCNNGG 1 cut(s) 234
BseGI GGATG 3 cut(s) 125, 168, 454
BseJI GATNNNNATC 1 cut(s) 414
BseMI GCAATG 1 cut(s) 489
BseMII CTCAG 1 cut(s) 453
BseXI GCAGC 1 cut(s) 466
BshFI GGCC 2 cut(s) 155, 471
BsnI GGCC 2 cut(s) 155, 471
Bsp143I GATC 8 cut(s) 52, 93, 220, 314, 365, 390, 415, 573
BspANI GGCC 2 cut(s) 155, 471
BspCNI CTCAG 1 cut(s) 454
BspPI GGATC 3 cut(s) 47, 228, 398
BsrDI GCAATG 1 cut(s) 489
BssECI CCNNGG 1 cut(s) 234
BssMI GATC 8 cut(s) 52, 93, 220, 314, 365, 390, 415, 573
BssT1I CCWWGG 1 cut(s) 234
Bst6I CTCTTC 3 cut(s) 296, 377, 482
BstDEI CTNAG 2 cut(s) 256, 462
BstF5I GGATG 3 cut(s) 125, 168, 454
BstKTI GATC 8 cut(s) 55, 96, 223, 317, 368, 393, 418, 576
BstMBI GATC 8 cut(s) 52, 93, 220, 314, 365, 390, 415, 573
BstV1I GCAGC 1 cut(s) 466
BstX2I RGATCY 3 cut(s) 220, 314, 365
BstYI RGATCY 3 cut(s) 220, 314, 365
BsuRI GGCC 2 cut(s) 155, 471
BtsCI GGATG 3 cut(s) 125, 168, 454
Cfr13I GGNCC 2 cut(s) 470, 536
Csp6I GTAC 2 cut(s) 48, 350
CspCI CAANNNNNGTGG 1 cut(s) 38
CviJI RGCY 4 cut(s) 26, 31, 155, 471
CviKI_1 RGCY 4 cut(s) 26, 31, 155, 471
CviQI GTAC 2 cut(s) 48, 350
DdeI CTNAG 2 cut(s) 256, 462
DpnI GATC 8 cut(s) 54, 95, 222, 316, 367, 392, 417, 575
DpnII GATC 8 cut(s) 52, 93, 220, 314, 365, 390, 415, 573
Eam1104I CTCTTC 3 cut(s) 296, 377, 482
EarI CTCTTC 3 cut(s) 296, 377, 482
Eco130I CCWWGG 1 cut(s) 234
Eco47I GGWCC 1 cut(s) 536
Eco57I CTGAAG 1 cut(s) 432
EcoT14I CCWWGG 1 cut(s) 234
ErhI CCWWGG 1 cut(s) 234
FaiI YATR 4 cut(s) 78, 99, 117, 322
FbaI TGATCA 1 cut(s) 415
Fnu4HI GCNGC 1 cut(s) 480
FokI GGATG 3 cut(s) 132, 175, 441
Fsp4HI GCNGC 1 cut(s) 480
FspBI CTAG 2 cut(s) 11, 57
GluI GCNGC 1 cut(s) 480
HaeIII GGCC 2 cut(s) 155, 471
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
HinfI GANTC 1 cut(s) 410
HphI GGTGA 4 cut(s) 16, 275, 543, 550
Hpy166II GTNNAC 2 cut(s) 7, 109
Hpy188I TCNGA 4 cut(s) 220, 415, 463, 545
Hpy188III TCNNGA 4 cut(s) 224, 394, 499, 577
Hpy8I GTNNAC 2 cut(s) 7, 109
Hpy99I CGWCG 1 cut(s) 432
HpyAV CCTTC 4 cut(s) 58, 283, 461, 496
HpyCH4V TGCA 3 cut(s) 80, 166, 482
HpyF3I CTNAG 2 cut(s) 256, 462
Ksp22I TGATCA 1 cut(s) 415
Kzo9I GATC 8 cut(s) 52, 93, 220, 314, 365, 390, 415, 573
LpnPI CCDG 3 cut(s) 293, 484, 567
Lsp1109I GCAGC 1 cut(s) 466
LweI GCATC 1 cut(s) 153
MaeI CTAG 2 cut(s) 11, 57
MaeIII GTNAC 2 cut(s) 197, 556
MalI GATC 8 cut(s) 54, 95, 222, 316, 367, 392, 417, 575
MboI GATC 8 cut(s) 52, 93, 220, 314, 365, 390, 415, 573
MboII GAAGA 7 cut(s) 49, 148, 200, 313, 364, 438, 499
MfeI CAATTG 2 cut(s) 474, 562
MflI RGATCY 3 cut(s) 220, 314, 365
MluCI AATT 6 cut(s) 81, 170, 267, 474, 547, 562
MmeI TCCRAC 1 cut(s) 514
MnlI CCTC 3 cut(s) 153, 297, 457
MseI TTAA 1 cut(s) 336
MunI CAATTG 2 cut(s) 474, 562
NdeII GATC 8 cut(s) 52, 93, 220, 314, 365, 390, 415, 573
NmeAIII GCCGAG 1 cut(s) 7
NmuCI GTSAC 2 cut(s) 197, 556
PfeI GAWTC 1 cut(s) 410
PkrI GCNGC 1 cut(s) 481
PspPI GGNCC 2 cut(s) 470, 536
PsuI RGATCY 3 cut(s) 220, 314, 365
RsaI GTAC 2 cut(s) 49, 351
RsaNI GTAC 2 cut(s) 48, 350
SaqAI TTAA 1 cut(s) 336
SatI GCNGC 1 cut(s) 480
Sau3AI GATC 8 cut(s) 52, 93, 220, 314, 365, 390, 415, 573
Sau96I GGNCC 2 cut(s) 470, 536
SetI ASST 6 cut(s) 12, 236, 294, 507, 541, 556
SfaNI GCATC 1 cut(s) 153
SinI GGWCC 1 cut(s) 536
SmlI CTYRAG 1 cut(s) 401
SmoI CTYRAG 1 cut(s) 401
Sse9I AATT 6 cut(s) 81, 170, 267, 474, 547, 562
SspMI CTAG 2 cut(s) 11, 57
StyI CCWWGG 1 cut(s) 234
TaqI TCGA 2 cut(s) 276, 576
TasI AATT 6 cut(s) 81, 170, 267, 474, 547, 562
TatI WGTACW 1 cut(s) 47
TfiI GAWTC 1 cut(s) 410
Tru1I TTAA 1 cut(s) 336
Tru9I TTAA 1 cut(s) 336
TseFI GTSAC 2 cut(s) 197, 556
TseI GCWGC 1 cut(s) 479
Tsp45I GTSAC 2 cut(s) 197, 556
TspDTI ATGAA 5 cut(s) 120, 158, 201, 221, 500
VpaK11BI GGWCC 1 cut(s) 536
XapI RAATTY 3 cut(s) 170, 267, 547
XspI CTAG 2 cut(s) 11, 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.