Rh5CG095200

protein dimerization activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
7514898 .. 7516770
1873 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG095200.1

Sequence Viewer

Length: 396 bp
ATGAAGATGAAGACCATGATTGGCAAAGCCCAATCAACTCTTCATGACCAACCCACGAAGTCAAATAAGGCTTGGGAAGAACATTGTACTGGTCCTAGTTTGAAGGGTTTTGAATATGCAATTAGTGATTTGATCTATAATGGTGTTGACCCTTATGGATGGGAGTTTTCATTGAAGATGATGAAAATAAAGGCCAATAGGATGCAGAAATTTATTTCAGTAAATGAAGATTTGCGTGACGAGATGAAAGTTCTTTTGGATCTTGAACAGACCTTGGAAGTCATCACTACCAACTTAGATGGTGAAATTTTGCTCGACTTCCAGCAGAAGGTAGAGTGGAAGAGGCAGGAGGTTGAGAATTTGAAAGAGATCTCTATGTGGAACAACACTTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

131

Amino Acids

15.41

Weight (kDa)

5.24

Isoelectric Point (pI)

32.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 267
AcsI RAATTY 3 cut(s) 209, 306, 358
AfaI GTAC 1 cut(s) 88
AfiI CCNNNNNNNGG 1 cut(s) 328
AgsI TTSAA 5 cut(s) 103, 113, 175, 266, 364
AjuI GAANNNNNNNTTGG 4 cut(s) 24, 56, 239, 271
AlwI GGATC 1 cut(s) 267
AoxI GGCC 1 cut(s) 192
ApoI RAATTY 3 cut(s) 209, 306, 358
AspS9I GGNCC 1 cut(s) 92
AsuHPI GGTGA 1 cut(s) 314
AvaII GGWCC 1 cut(s) 92
BbsI GAAGAC 1 cut(s) 17
BccI CCATC 2 cut(s) 153, 293
BfaI CTAG 1 cut(s) 96
BglII AGATCT 1 cut(s) 369
Bme18I GGWCC 1 cut(s) 92
BmgT120I GGNCC 1 cut(s) 92
BmsI GCATC 1 cut(s) 192
BpiI GAAGAC 1 cut(s) 17
BsaJI CCNNGG 1 cut(s) 273
Bsc4I CCNNNNNNNGG 1 cut(s) 328
Bse1I ACTGG 1 cut(s) 94
BseDI CCNNGG 1 cut(s) 273
BseGI GGATG 2 cut(s) 164, 207
BseLI CCNNNNNNNGG 1 cut(s) 328
BseNI ACTGG 1 cut(s) 94
BshFI GGCC 1 cut(s) 194
BslI CCNNNNNNNGG 1 cut(s) 328
BsnI GGCC 1 cut(s) 194
Bsp143I GATC 3 cut(s) 132, 259, 369
BspANI GGCC 1 cut(s) 194
BspHI TCATGA 1 cut(s) 43
BspPI GGATC 1 cut(s) 267
BsrI ACTGG 1 cut(s) 94
BssECI CCNNGG 1 cut(s) 273
BssMI GATC 3 cut(s) 132, 259, 369
BssT1I CCWWGG 1 cut(s) 273
Bst6I CTCTTC 2 cut(s) 45, 335
BstDEI CTNAG 1 cut(s) 295
BstF5I GGATG 2 cut(s) 164, 207
BstKTI GATC 3 cut(s) 135, 262, 372
BstMBI GATC 3 cut(s) 132, 259, 369
BstV2I GAAGAC 1 cut(s) 17
BstX2I RGATCY 2 cut(s) 259, 369
BstYI RGATCY 2 cut(s) 259, 369
BsuRI GGCC 1 cut(s) 194
BtsCI GGATG 2 cut(s) 164, 207
CciI TCATGA 1 cut(s) 43
Cfr13I GGNCC 1 cut(s) 92
Csp6I GTAC 1 cut(s) 87
CviAII CATG 2 cut(s) 16, 44
CviJI RGCY 3 cut(s) 29, 71, 194
CviKI_1 RGCY 3 cut(s) 29, 71, 194
CviQI GTAC 1 cut(s) 87
DdeI CTNAG 1 cut(s) 295
DpnI GATC 3 cut(s) 134, 261, 371
DpnII GATC 3 cut(s) 132, 259, 369
Eam1104I CTCTTC 2 cut(s) 45, 335
EarI CTCTTC 2 cut(s) 45, 335
Eco130I CCWWGG 1 cut(s) 273
Eco47I GGWCC 1 cut(s) 92
EcoT14I CCWWGG 1 cut(s) 273
ErhI CCWWGG 1 cut(s) 273
FaeI CATG 2 cut(s) 19, 47
FaiI YATR 6 cut(s) 17, 45, 117, 138, 156, 377
FatI CATG 2 cut(s) 15, 43
FokI GGATG 2 cut(s) 171, 214
FspBI CTAG 1 cut(s) 96
HaeIII GGCC 1 cut(s) 194
Hin1II CATG 2 cut(s) 19, 47
HincII GTYRAC 1 cut(s) 148
HindII GTYRAC 1 cut(s) 148
HphI GGTGA 1 cut(s) 314
Hpy166II GTNNAC 1 cut(s) 148
Hpy188III TCNNGA 2 cut(s) 44, 263
Hpy8I GTNNAC 1 cut(s) 148
HpyAV CCTTC 2 cut(s) 97, 322
HpyCH4V TGCA 2 cut(s) 119, 205
HpyF3I CTNAG 1 cut(s) 295
Hsp92II CATG 2 cut(s) 19, 47
Kzo9I GATC 3 cut(s) 132, 259, 369
LpnPI CCDG 3 cut(s) 75, 332, 335
LweI GCATC 1 cut(s) 192
MaeI CTAG 1 cut(s) 96
MaeIII GTNAC 1 cut(s) 236
MalI GATC 3 cut(s) 134, 261, 371
MboI GATC 3 cut(s) 132, 259, 369
MboII GAAGA 7 cut(s) 16, 22, 32, 89, 187, 239, 352
MflI RGATCY 2 cut(s) 259, 369
MluCI AATT 4 cut(s) 120, 209, 306, 358
MnlI CCTC 2 cut(s) 336, 343
NdeII GATC 3 cut(s) 132, 259, 369
NlaIII CATG 2 cut(s) 19, 47
NmuCI GTSAC 1 cut(s) 236
PagI TCATGA 1 cut(s) 43
PspPI GGNCC 1 cut(s) 92
PsuI RGATCY 2 cut(s) 259, 369
RsaI GTAC 1 cut(s) 88
RsaNI GTAC 1 cut(s) 87
Sau3AI GATC 3 cut(s) 132, 259, 369
Sau96I GGNCC 1 cut(s) 92
SetI ASST 3 cut(s) 275, 333, 354
SfaNI GCATC 1 cut(s) 192
SinI GGWCC 1 cut(s) 92
Sse9I AATT 4 cut(s) 120, 209, 306, 358
SspMI CTAG 1 cut(s) 96
StyI CCWWGG 1 cut(s) 273
TaqI TCGA 1 cut(s) 315
TasI AATT 4 cut(s) 120, 209, 306, 358
TatI WGTACW 1 cut(s) 86
TseFI GTSAC 1 cut(s) 236
Tsp45I GTSAC 1 cut(s) 236
TspDTI ATGAA 7 cut(s) 17, 23, 32, 159, 197, 240, 260
VpaK11BI GGWCC 1 cut(s) 92
XapI RAATTY 3 cut(s) 209, 306, 358
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.