Rorug01G0113900

Domain of unknown function (DUF3475)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0002649
Physical Location & Seq
Reverse (-)
20181478 .. 20181912
435 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0113900.1

Sequence Viewer

Length: 435 bp
ATGCTTGATGCTCTTGTCAGATACTATGACAAAGAAAGCATGTGTTTTAAAGTTGGGAACAAATCTTTATTCTTTGGTTTAGAAGACGTCATTTACATCACTGGGCTTAGGATAGAAGACAAGCTAGTGATAAAAGGAGACGTAAAAATTGTAAGGGACCTAGAGAACAACCAGTCTATTACCATACAAGGGTTGGGGCAAGTGAATAGAGACTTGGTTACAGGTAAGTCTGTGAAGTTTGAAGGGTTACAAAAGGCATTCTACACTATACCCGATGATGTAGATGTAAACAACGACAGATTTGGTGATTATGTTAGAGCATTTGTGCTTTATGTAATAGGGACGGTACTATTACATACTACAGATCATGAAACTGTGACTTTAAGCTACTTGGAGGCTTTGTCAGACATTGGGGAAATAAGGAACCTTGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3475 DUF668

Protein Analysis

144

Amino Acids

16.33

Weight (kDa)

4.86

Isoelectric Point (pI)

15.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1985 PF09331 9 - 141 1.4e-06 Domain of unknown function (DUF1985)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 90
AcyI GRCGYC 1 cut(s) 87
AfaI GTAC 1 cut(s) 348
AfiI CCNNNNNNNGG 1 cut(s) 189
AgsI TTSAA 1 cut(s) 242
AjuI GAANNNNNNNTTGG 2 cut(s) 197, 229
AluBI AGCT 2 cut(s) 124, 387
AluI AGCT 2 cut(s) 124, 387
Alw26I GTCTC 2 cut(s) 132, 204
AspS9I GGNCC 1 cut(s) 157
AsuHPI GGTGA 1 cut(s) 317
AvaII GGWCC 1 cut(s) 157
BbsI GAAGAC 2 cut(s) 90, 123
BcoDI GTCTC 2 cut(s) 132, 204
BfaI CTAG 2 cut(s) 125, 161
BfmI CTRYAG 1 cut(s) 360
Bme18I GGWCC 1 cut(s) 157
BmgT120I GGNCC 1 cut(s) 157
BmiI GGNNCC 2 cut(s) 158, 425
BmrI ACTGGG 1 cut(s) 111
BmuI ACTGGG 1 cut(s) 111
BpiI GAAGAC 2 cut(s) 90, 123
Bpu10I CCTNAGC 1 cut(s) 107
BsaHI GRCGYC 1 cut(s) 87
BsaXI ACNNNNNCTCC 2 cut(s) 386, 416
Bsc4I CCNNNNNNNGG 1 cut(s) 189
Bse1I ACTGG 2 cut(s) 106, 172
BseLI CCNNNNNNNGG 1 cut(s) 189
BseNI ACTGG 2 cut(s) 106, 172
BslFI GGGAC 2 cut(s) 170, 355
BslI CCNNNNNNNGG 1 cut(s) 189
BsmAI GTCTC 2 cut(s) 132, 204
BsmBI CGTCTC 1 cut(s) 132
BsmFI GGGAC 2 cut(s) 170, 355
BsmI GAATGC 1 cut(s) 257
Bsp143I GATC 1 cut(s) 364
BspHI TCATGA 1 cut(s) 367
BspLI GGNNCC 2 cut(s) 158, 425
BsrI ACTGG 2 cut(s) 106, 172
BssMI GATC 1 cut(s) 364
BssNI GRCGYC 1 cut(s) 87
Bst4CI ACNGT 2 cut(s) 346, 376
BstACI GRCGYC 1 cut(s) 87
BstDEI CTNAG 1 cut(s) 107
BstKTI GATC 1 cut(s) 367
BstMAI GTCTC 2 cut(s) 132, 204
BstMBI GATC 1 cut(s) 364
BstNSI RCATGY 1 cut(s) 43
BstSFI CTRYAG 1 cut(s) 360
BstV2I GAAGAC 2 cut(s) 90, 123
BtsIMutI CAGTG 1 cut(s) 99
CciI TCATGA 1 cut(s) 367
Cfr13I GGNCC 1 cut(s) 157
Csp6I GTAC 1 cut(s) 347
CviAII CATG 2 cut(s) 40, 368
CviJI RGCY 4 cut(s) 106, 124, 387, 398
CviKI_1 RGCY 4 cut(s) 106, 124, 387, 398
CviQI GTAC 1 cut(s) 347
DdeI CTNAG 1 cut(s) 107
DpnI GATC 1 cut(s) 366
DpnII GATC 1 cut(s) 364
DraI TTTAAA 1 cut(s) 49
Eco47I GGWCC 1 cut(s) 157
EcoO109I RGGNCCY 1 cut(s) 157
Esp3I CGTCTC 1 cut(s) 132
FaeI CATG 2 cut(s) 43, 371
FaiI YATR 9 cut(s) 27, 41, 185, 269, 312, 333, 357, 369, 433
FaqI GGGAC 2 cut(s) 170, 355
FatI CATG 2 cut(s) 39, 367
FspBI CTAG 2 cut(s) 125, 161
Hin1I GRCGYC 1 cut(s) 87
Hin1II CATG 2 cut(s) 43, 371
HphI GGTGA 1 cut(s) 317
Hpy166II GTNNAC 1 cut(s) 289
Hpy188I TCNGA 2 cut(s) 20, 406
Hpy188III TCNNGA 1 cut(s) 368
Hpy8I GTNNAC 1 cut(s) 289
HpyAV CCTTC 1 cut(s) 236
HpyCH4III ACNGT 2 cut(s) 346, 376
HpyCH4IV ACGT 2 cut(s) 87, 141
HpyF3I CTNAG 1 cut(s) 107
HpySE526I ACGT 2 cut(s) 87, 141
Hsp92I GRCGYC 1 cut(s) 87
Hsp92II CATG 2 cut(s) 43, 371
Kzo9I GATC 1 cut(s) 364
LpnPI CCDG 3 cut(s) 87, 185, 207
MaeI CTAG 2 cut(s) 125, 161
MaeII ACGT 2 cut(s) 87, 141
MaeIII GTNAC 3 cut(s) 217, 246, 376
MalI GATC 1 cut(s) 366
MboI GATC 1 cut(s) 364
MboII GAAGA 2 cut(s) 95, 128
MluCI AATT 1 cut(s) 147
MnlI CCTC 1 cut(s) 388
MseI TTAA 2 cut(s) 48, 383
Mva1269I GAATGC 1 cut(s) 257
NdeII GATC 1 cut(s) 364
NlaIII CATG 2 cut(s) 43, 371
NlaIV GGNNCC 2 cut(s) 158, 425
NmuCI GTSAC 1 cut(s) 376
NspI RCATGY 1 cut(s) 43
PagI TCATGA 1 cut(s) 367
PctI GAATGC 1 cut(s) 257
PpuMI RGGWCCY 1 cut(s) 157
Psp5II RGGWCCY 1 cut(s) 157
PspN4I GGNNCC 2 cut(s) 158, 425
PspPI GGNCC 1 cut(s) 157
PspPPI RGGWCCY 1 cut(s) 157
RsaI GTAC 1 cut(s) 348
RsaNI GTAC 1 cut(s) 347
SaqAI TTAA 2 cut(s) 48, 383
Sau3AI GATC 1 cut(s) 364
Sau96I GGNCC 1 cut(s) 157
SetI ASST 7 cut(s) 90, 126, 144, 162, 226, 389, 429
SfcI CTRYAG 1 cut(s) 360
SinI GGWCC 1 cut(s) 157
Sse9I AATT 1 cut(s) 147
SspMI CTAG 2 cut(s) 125, 161
TaaI ACNGT 2 cut(s) 346, 376
TaiI ACGT 2 cut(s) 90, 144
TasI AATT 1 cut(s) 147
Tru1I TTAA 2 cut(s) 48, 383
Tru9I TTAA 2 cut(s) 48, 383
TscAI CASTG 1 cut(s) 106
TseFI GTSAC 1 cut(s) 376
Tsp45I GTSAC 1 cut(s) 376
TspDTI ATGAA 1 cut(s) 384
TspRI CASTG 1 cut(s) 106
VpaK11BI GGWCC 1 cut(s) 157
XceI RCATGY 1 cut(s) 43
XcmI CCANNNNNNNNNTGG 1 cut(s) 190
XspI CTAG 2 cut(s) 125, 161
ZraI GACGTC 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.