Rroxscaffold_2G00103220

Nudix hydrolase 15

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
25696933 .. 25703377
6445 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00103220.1

Sequence Viewer

Length: 231 bp
ATGTTCATCAAGGATGAAAACAGGAGGGCAGAGGAGAGAGAGTGGATGGGTAACAAATACCTGATTCATTTCTTTGACTATGAAACCAACAACAAGAAGTACATGATATGGGGCTTAACTGCTGAAAATGAAACACCTGGATGGACCCAACTGAAGCTTCCTGGTCAAGCTCCTTCTGCACGTTGTGGCCATACCATCACATCTGGAGGACACTATGTACTTTACCTGTAA

Protein Analysis

76

Amino Acids

8.96

Weight (kDa)

6.82

Isoelectric Point (pI)

40.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 187
AcuI CTGAAG 1 cut(s) 173
AdeI CACNNNGTG 1 cut(s) 185
AfaI GTAC 2 cut(s) 101, 219
AjnI CCWGG 2 cut(s) 136, 160
AjuI GAANNNNNNNTTGG 2 cut(s) 141, 173
AluBI AGCT 2 cut(s) 157, 170
AluI AGCT 2 cut(s) 157, 170
AoxI GGCC 1 cut(s) 187
AspS9I GGNCC 1 cut(s) 144
AvaII GGWCC 1 cut(s) 144
BalI TGGCCA 1 cut(s) 189
BccI CCATC 3 cut(s) 40, 135, 203
BciT130I CCWGG 2 cut(s) 138, 162
Bme1390I CCNGG 2 cut(s) 138, 162
Bme18I GGWCC 1 cut(s) 144
BmgT120I GGNCC 1 cut(s) 144
BmiI GGNNCC 1 cut(s) 146
BmrFI CCNGG 2 cut(s) 138, 162
BpmI CTGGAG 1 cut(s) 225
BsaXI ACNNNNNCTCC 2 cut(s) 26, 56
BseBI CCWGG 2 cut(s) 138, 162
BseGI GGATG 3 cut(s) 19, 51, 146
BseRI GAGGAG 1 cut(s) 47
BsgI GTGCAG 1 cut(s) 162
BshFI GGCC 1 cut(s) 189
BsnI GGCC 1 cut(s) 189
BspANI GGCC 1 cut(s) 189
BspLI GGNNCC 1 cut(s) 146
Bst2UI CCWGG 2 cut(s) 138, 162
BstF5I GGATG 3 cut(s) 19, 51, 146
BstMWI GCNNNNNNNGC 1 cut(s) 176
BstNI CCWGG 2 cut(s) 138, 162
BstSCI CCNGG 2 cut(s) 136, 160
BsuRI GGCC 1 cut(s) 189
BtsCI GGATG 3 cut(s) 19, 51, 146
Cfr13I GGNCC 1 cut(s) 144
Csp6I GTAC 2 cut(s) 100, 218
CviAII CATG 1 cut(s) 103
CviJI RGCY 4 cut(s) 114, 157, 170, 189
CviKI_1 RGCY 4 cut(s) 114, 157, 170, 189
CviQI GTAC 2 cut(s) 100, 218
DraIII CACNNNGTG 1 cut(s) 185
EaeI YGGCCR 1 cut(s) 187
Eco47I GGWCC 1 cut(s) 144
Eco57I CTGAAG 1 cut(s) 173
EcoRII CCWGG 2 cut(s) 136, 160
FaeI CATG 1 cut(s) 106
FaiI YATR 5 cut(s) 81, 104, 109, 192, 216
FatI CATG 1 cut(s) 102
FokI GGATG 3 cut(s) 26, 58, 153
GsuI CTGGAG 1 cut(s) 225
HaeIII GGCC 1 cut(s) 189
Hin1II CATG 1 cut(s) 106
HindIII AAGCTT 1 cut(s) 155
HinfI GANTC 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 204
HpyAV CCTTC 1 cut(s) 183
HpyCH4IV ACGT 1 cut(s) 181
HpyCH4V TGCA 1 cut(s) 179
HpyF10VI GCNNNNNNNGC 1 cut(s) 176
HpySE526I ACGT 1 cut(s) 181
Hsp92II CATG 1 cut(s) 106
LmnI GCTCC 1 cut(s) 175
LpnPI CCDG 7 cut(s) 7, 74, 123, 147, 150, 174, 189
MaeII ACGT 1 cut(s) 181
MaeIII GTNAC 1 cut(s) 50
MlsI TGGCCA 1 cut(s) 189
MluNI TGGCCA 1 cut(s) 189
MnlI CCTC 3 cut(s) 18, 25, 200
Mox20I TGGCCA 1 cut(s) 189
MscI TGGCCA 1 cut(s) 189
MseI TTAA 1 cut(s) 116
MslI CAYNNNNRTG 1 cut(s) 139
Msp20I TGGCCA 1 cut(s) 189
MspR9I CCNGG 2 cut(s) 138, 162
MvaI CCWGG 2 cut(s) 138, 162
MwoI GCNNNNNNNGC 1 cut(s) 176
NlaIII CATG 1 cut(s) 106
NlaIV GGNNCC 1 cut(s) 146
PfeI GAWTC 1 cut(s) 64
Psp6I CCWGG 2 cut(s) 136, 160
PspGI CCWGG 2 cut(s) 136, 160
PspN4I GGNNCC 1 cut(s) 146
PspPI GGNCC 1 cut(s) 144
RsaI GTAC 2 cut(s) 101, 219
RsaNI GTAC 2 cut(s) 100, 218
RseI CAYNNNNRTG 1 cut(s) 139
SaqAI TTAA 1 cut(s) 116
Sau96I GGNCC 1 cut(s) 144
ScrFI CCNGG 2 cut(s) 138, 162
SetI ASST 6 cut(s) 63, 139, 159, 172, 184, 228
SinI GGWCC 1 cut(s) 144
SmiMI CAYNNNNRTG 1 cut(s) 139
StyD4I CCNGG 2 cut(s) 136, 160
TaiI ACGT 1 cut(s) 184
TatI WGTACW 2 cut(s) 99, 217
TfiI GAWTC 1 cut(s) 64
Tru1I TTAA 1 cut(s) 116
Tru9I TTAA 1 cut(s) 116
TspDTI ATGAA 4 cut(s) 30, 56, 96, 144
VpaK11BI GGWCC 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.