Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000002

Orthogroup ID

OG0008894

Physical Location & Seq

Genomic Coordinates Reverse (-)

41711714 .. 41715121

Gene Structure 3408 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_2G00115450.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 687 bp

ATGGGACCGCCTCTTCCCTCTCTAGGCCCCGGTGACCTGGGATTTTGGATTTTTGGCCGTGAAAGTCCGGATCGAAGCAAGGATTGCTCCGGTTGTAGTTTTGGGATTTCACCGATTTTCGGCCATTCCGCCACCTCCGCCACCAAGTTAACATCGAAGGTTCGGTTTTTGATGGAGATTATTTCCCCTAAAGTAGTTCATCCCAATTTGCATCGTAGAGGTGGGTCCCGCAGGGCCACTTCGGATTCCGGGGTGGAATTCGGGGTGGGTCTTGTCATACGTAACTTGAATCTCATCTGTCTTAGGTGTGTGAACAAGTTTATACCTATATTACGCCACAAGTGGTCACCGACCGTGATCACCAAGAGGACGAATGCTGGAGAAGCAAACAAGGAAAAAATTGGGAACACACATCGAGTAGAGTTGGCCTTCTTTGTTGGATTCGGTCACTTGTGTTTCGACAGTGCAGATGAATCGGCATTCGTGGCTTGGTTTTGGCGACTATCTTGGGCTGTGGGTGGACCAGCTCTCGGAGAACGTCGCGGGTCTTTTGGCGATGGAGGAAGACCAGTGGATCGTAGAGGTCGCAGTGATCGCGGTGTGCTTATCGGGTTCGTGCGAGGTCGGATTCCGATATTGAGTGCGGGGTCCGCCCGTTCTCCTTATTTTGATTTGGAGGGGCAGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

228

Amino Acids

24.88

Weight (kDa)

10.32

Isoelectric Point (pI)

47.79

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008894)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0326701 RchiOBHm_Chr1g0382121 RchiOBHm_Chr2g0112531 RchiOBHm_Chr2g0112991 RchiOBHm_Chr2g0114721 RchiOBHm_Chr2g0127921 RchiOBHm_Chr2g0127931 RchiOBHm_Chr2g0127941 RchiOBHm_Chr3g0495381 RchiOBHm_Chr4g0416991 RchiOBHm_Chr4g0429081 RchiOBHm_Chr4g0442281 RchiOBHm_Chr5g0078891 RchiOBHm_Chr6g0263681 RchiOBHm_Chr6g0266391 RchiOBHm_Chr6g0302751 RchiOBHm_Chr7g0187251 RchiOBHm_Chr7g0205541
rosa_multiflora	Rmu_sc0000026.1_g000001
rosa_roxburghii	Rroxscaffold_2G00115450 Rroxscaffold_6G00398760
rosa_samantha	Rh6CG368200 Rh7AG027600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	2 cut(s)	543, 597
AccIII	TCCGGA	1 cut(s)	67
AciI	CCGC	8 cut(s)	8, 129, 138, 229, 543, 597, 644, 651
AclWI	GGATC	2 cut(s)	78, 582
AcoI	YGGCCR	2 cut(s)	55, 121
AcsI	RAATTY	1 cut(s)	257
AfiI	CCNNNNNNNGG	3 cut(s)	23, 119, 530
AgsI	TTSAA	1 cut(s)	289
AjnI	CCWGG	1 cut(s)	36
AluBI	AGCT	1 cut(s)	527
AluI	AGCT	1 cut(s)	527
AlwI	GGATC	2 cut(s)	78, 582
Aor13HI	TCCGGA	1 cut(s)	67
AoxI	GGCC	5 cut(s)	25, 55, 121, 234, 426
ApoI	RAATTY	1 cut(s)	257
AspS9I	GGNCC	6 cut(s)	5, 26, 225, 234, 521, 648
AsuC2I	CCSGG	2 cut(s)	30, 250
AsuHPI	GGTGA	4 cut(s)	44, 102, 339, 352
AvaII	GGWCC	4 cut(s)	5, 225, 521, 648
BbsI	GAAGAC	1 cut(s)	571
BccI	CCATC	2 cut(s)	166, 551
BceAI	ACGGC	1 cut(s)	42
BcgI	CGANNNNNNTGC	2 cut(s)	456, 490
BciT130I	CCWGG	1 cut(s)	38
BclI	TGATCA	1 cut(s)	357
BcnI	CCSGG	2 cut(s)	30, 250
BfaI	CTAG	1 cut(s)	23
Bme1390I	CCNGG	3 cut(s)	30, 38, 250
Bme18I	GGWCC	4 cut(s)	5, 225, 521, 648
BmgT120I	GGNCC	6 cut(s)	5, 26, 225, 234, 521, 648
BmiI	GGNNCC	5 cut(s)	6, 28, 226, 227, 649
BmrFI	CCNGG	3 cut(s)	30, 38, 250
BmsI	GCATC	1 cut(s)	220
BpiI	GAAGAC	1 cut(s)	571
BpmI	CTGGAG	1 cut(s)	399
BpuMI	CCSGG	2 cut(s)	30, 250
BsaAI	YACGTR	1 cut(s)	281
BsaJI	CCNNGG	3 cut(s)	28, 37, 249
BsaWI	WCCGGW	2 cut(s)	67, 89
BsaXI	ACNNNNNCTCC	1 cut(s)	668
Bsc4I	CCNNNNNNNGG	3 cut(s)	23, 119, 530
Bse1I	ACTGG	1 cut(s)	569
BseAI	TCCGGA	1 cut(s)	67
BseBI	CCWGG	1 cut(s)	38
BseDI	CCNNGG	3 cut(s)	28, 37, 249
BseGI	GGATG	1 cut(s)	199
BseLI	CCNNNNNNNGG	3 cut(s)	23, 119, 530
BseNI	ACTGG	1 cut(s)	569
BsgI	GTGCAG	1 cut(s)	486
Bsh1236I	CGCG	2 cut(s)	543, 597
Bsh1285I	CGRYCG	1 cut(s)	354
BshFI	GGCC	5 cut(s)	27, 57, 123, 236, 428
BsiEI	CGRYCG	1 cut(s)	354
BsiSI	CCGG	4 cut(s)	30, 68, 90, 249
BslFI	GGGAC	2 cut(s)	18, 211
BslI	CCNNNNNNNGG	3 cut(s)	23, 119, 530
BsmFI	GGGAC	2 cut(s)	18, 211
BsmI	GAATGC	2 cut(s)	379, 479
BsnI	GGCC	5 cut(s)	27, 57, 123, 236, 428
Bsp13I	TCCGGA	1 cut(s)	67
Bsp143I	GATC	4 cut(s)	70, 357, 574, 592
BspACI	CCGC	8 cut(s)	8, 129, 138, 229, 543, 597, 644, 651
BspANI	GGCC	5 cut(s)	27, 57, 123, 236, 428
BspEI	TCCGGA	1 cut(s)	67
BspFNI	CGCG	2 cut(s)	543, 597
BspLI	GGNNCC	5 cut(s)	6, 28, 226, 227, 649
BspPI	GGATC	2 cut(s)	78, 582
BsrI	ACTGG	1 cut(s)	569
BssECI	CCNNGG	3 cut(s)	28, 37, 249
BssMI	GATC	4 cut(s)	70, 357, 574, 592
Bst2UI	CCWGG	1 cut(s)	38
Bst4CI	ACNGT	2 cut(s)	355, 464
Bst6I	CTCTTC	1 cut(s)	18
BstAPI	GCANNNNNTGC	1 cut(s)	84
BstBAI	YACGTR	1 cut(s)	281
BstDEI	CTNAG	1 cut(s)	302
BstEII	GGTNACC	2 cut(s)	32, 345
BstF5I	GGATG	1 cut(s)	199
BstFNI	CGCG	2 cut(s)	543, 597
BstKTI	GATC	4 cut(s)	73, 360, 577, 595
BstMBI	GATC	4 cut(s)	70, 357, 574, 592
BstMCI	CGRYCG	1 cut(s)	354
BstMWI	GCNNNNNNNGC	6 cut(s)	84, 137, 383, 485, 594, 650
BstNI	CCWGG	1 cut(s)	38
BstPI	GGTNACC	2 cut(s)	32, 345
BstSCI	CCNGG	3 cut(s)	28, 36, 248
BstSNI	TACGTA	1 cut(s)	281
BstUI	CGCG	2 cut(s)	543, 597
BstV2I	GAAGAC	1 cut(s)	571
BsuRI	GGCC	5 cut(s)	27, 57, 123, 236, 428
BtgZI	GCGATG	1 cut(s)	570
BtsCI	GGATG	1 cut(s)	199
BtsI	GCAGTG	1 cut(s)	595
BtsIMutI	CAGTG	3 cut(s)	469, 576, 595
Cfr13I	GGNCC	6 cut(s)	5, 26, 225, 234, 521, 648
CviJI	RGCY	8 cut(s)	27, 57, 123, 236, 428, 488, 512, 527
CviKI_1	RGCY	8 cut(s)	27, 57, 123, 236, 428, 488, 512, 527
DdeI	CTNAG	1 cut(s)	302
DpnI	GATC	4 cut(s)	72, 359, 576, 594
DpnII	GATC	4 cut(s)	70, 357, 574, 592
EaeI	YGGCCR	2 cut(s)	55, 121
Eam1104I	CTCTTC	1 cut(s)	18
EarI	CTCTTC	1 cut(s)	18
EciI	GGCGGA	3 cut(s)	118, 127, 640
Eco105I	TACGTA	1 cut(s)	281
Eco47I	GGWCC	4 cut(s)	5, 225, 521, 648
Eco91I	GGTNACC	2 cut(s)	32, 345
EcoO109I	RGGNCCY	2 cut(s)	26, 225
EcoO65I	GGTNACC	2 cut(s)	32, 345
EcoRI	GAATTC	1 cut(s)	257
EcoRII	CCWGG	1 cut(s)	36
FaiI	YATR	3 cut(s)	278, 323, 329
FaqI	GGGAC	2 cut(s)	18, 211
FauI	CCCGC	3 cut(s)	236, 536, 637
FbaI	TGATCA	1 cut(s)	357
FokI	GGATG	1 cut(s)	186
FspBI	CTAG	1 cut(s)	23
GsuI	CTGGAG	1 cut(s)	399
HaeIII	GGCC	5 cut(s)	27, 57, 123, 236, 428
HapII	CCGG	4 cut(s)	30, 68, 90, 249
HincII	GTYRAC	1 cut(s)	150
HindII	GTYRAC	1 cut(s)	150
HinfI	GANTC	5 cut(s)	245, 289, 441, 473, 628
HpaI	GTTAAC	1 cut(s)	150
HpaII	CCGG	4 cut(s)	30, 68, 90, 249
HphI	GGTGA	4 cut(s)	44, 102, 339, 352
Hpy166II	GTNNAC	3 cut(s)	150, 313, 521
Hpy188I	TCNGA	4 cut(s)	244, 533, 627, 633
Hpy188III	TCNNGA	1 cut(s)	68
Hpy8I	GTNNAC	3 cut(s)	150, 313, 521
Hpy99I	CGWCG	1 cut(s)	543
HpyAV	CCTTC	2 cut(s)	151, 439
HpyCH4III	ACNGT	2 cut(s)	355, 464
HpyCH4IV	ACGT	2 cut(s)	280, 538
HpyCH4V	TGCA	2 cut(s)	211, 467
HpyF10VI	GCNNNNNNNGC	6 cut(s)	84, 137, 383, 485, 594, 650
HpyF3I	CTNAG	1 cut(s)	302
HpySE526I	ACGT	2 cut(s)	280, 538
KflI	GGGWCCC	1 cut(s)	225
Kpn2I	TCCGGA	1 cut(s)	67
Ksp22I	TGATCA	1 cut(s)	357
KspAI	GTTAAC	1 cut(s)	150
Kzo9I	GATC	4 cut(s)	70, 357, 574, 592
LmnI	GCTCC	1 cut(s)	92
LweI	GCATC	1 cut(s)	220
MaeI	CTAG	1 cut(s)	23
MaeII	ACGT	2 cut(s)	280, 538
MaeIII	GTNAC	4 cut(s)	32, 281, 345, 446
MalI	GATC	4 cut(s)	72, 359, 576, 594
MboI	GATC	4 cut(s)	70, 357, 574, 592
MboII	GAAGA	2 cut(s)	5, 576
MluCI	AATT	3 cut(s)	205, 257, 399
MmeI	TCCRAC	2 cut(s)	418, 605
MnlI	CCTC	9 cut(s)	21, 28, 145, 212, 360, 554, 575, 614, 670
MroI	TCCGGA	1 cut(s)	67
MseI	TTAA	1 cut(s)	149
MspI	CCGG	4 cut(s)	30, 68, 90, 249
MspR9I	CCNGG	3 cut(s)	30, 38, 250
Mva1269I	GAATGC	2 cut(s)	379, 479
MvaI	CCWGG	1 cut(s)	38
MvnI	CGCG	2 cut(s)	543, 597
MwoI	GCNNNNNNNGC	6 cut(s)	84, 137, 383, 485, 594, 650
NciI	CCSGG	2 cut(s)	30, 250
NdeII	GATC	4 cut(s)	70, 357, 574, 592
NlaIV	GGNNCC	5 cut(s)	6, 28, 226, 227, 649
NmuCI	GTSAC	3 cut(s)	32, 345, 446
PctI	GAATGC	2 cut(s)	379, 479
PfeI	GAWTC	5 cut(s)	245, 289, 441, 473, 628
Ppu21I	YACGTR	1 cut(s)	281
PpuMI	RGGWCCY	1 cut(s)	225
Psp5II	RGGWCCY	1 cut(s)	225
Psp6I	CCWGG	1 cut(s)	36
PspEI	GGTNACC	2 cut(s)	32, 345
PspGI	CCWGG	1 cut(s)	36
PspN4I	GGNNCC	5 cut(s)	6, 28, 226, 227, 649
PspPI	GGNCC	6 cut(s)	5, 26, 225, 234, 521, 648
PspPPI	RGGWCCY	1 cut(s)	225
SaqAI	TTAA	1 cut(s)	149
Sau3AI	GATC	4 cut(s)	70, 357, 574, 592
Sau96I	GGNCC	6 cut(s)	5, 26, 225, 234, 521, 648
ScrFI	CCNGG	3 cut(s)	30, 38, 250
SfaNI	GCATC	1 cut(s)	220
SinI	GGWCC	4 cut(s)	5, 225, 521, 648
SnaBI	TACGTA	1 cut(s)	281
Sse9I	AATT	3 cut(s)	205, 257, 399
SsiI	CCGC	8 cut(s)	8, 129, 138, 229, 543, 597, 644, 651
SspMI	CTAG	1 cut(s)	23
StyD4I	CCNGG	3 cut(s)	28, 36, 248
TaaI	ACNGT	2 cut(s)	355, 464
TaiI	ACGT	2 cut(s)	283, 541
TaqI	TCGA	4 cut(s)	73, 155, 415, 459
TaqII	GACCGA	1 cut(s)	434
TasI	AATT	3 cut(s)	205, 257, 399
TfiI	GAWTC	5 cut(s)	245, 289, 441, 473, 628
Tru1I	TTAA	1 cut(s)	149
Tru9I	TTAA	1 cut(s)	149
TscAI	CASTG	3 cut(s)	469, 576, 595
TseFI	GTSAC	3 cut(s)	32, 345, 446
Tsp45I	GTSAC	3 cut(s)	32, 345, 446
TspDTI	ATGAA	2 cut(s)	188, 486
TspRI	CASTG	3 cut(s)	469, 576, 595
VpaK11BI	GGWCC	4 cut(s)	5, 225, 521, 648
XapI	RAATTY	1 cut(s)	257
XspI	CTAG	1 cut(s)	23

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.