Rroxscaffold_2G00138760

CDPK-related kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
76955521 .. 76956890
1370 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00138760.1

Sequence Viewer

Length: 207 bp
ATGAAGGACACATTGGTTTCAACAATAGACAGAGAGCAGGAGGTCGAGGGAATTGAAGGGAGTGGTGTTAAAGAAAATCAACCTGACATTAAAGGTTCATGCGAAGTACATGAACCTCCATCCCGATTCTTCAAGAGGCGGTTCTCAGTTCCTTCACCAGCAAAGCATATGAGGGCGCTTCTAGCAAGGGTGCTGGGGTTTTTTTAA

Protein Analysis

68

Amino Acids

7.69

Weight (kDa)

7.95

Isoelectric Point (pI)

56.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 139
AfaI GTAC 1 cut(s) 108
AgsI TTSAA 3 cut(s) 21, 56, 133
AjuI GAANNNNNNNTTGG 1 cut(s) 28
AspLEI GCGC 1 cut(s) 178
AsuHPI GGTGA 1 cut(s) 147
BccI CCATC 1 cut(s) 127
BfaI CTAG 1 cut(s) 182
BfoI RGCGCY 1 cut(s) 179
BseGI GGATG 1 cut(s) 119
BseMII CTCAG 1 cut(s) 159
BseYI CCCAGC 1 cut(s) 193
BspACI CCGC 1 cut(s) 139
BspCNI CTCAG 1 cut(s) 158
BstDEI CTNAG 1 cut(s) 145
BstF5I GGATG 1 cut(s) 119
BstH2I RGCGCY 1 cut(s) 179
BstHHI GCGC 1 cut(s) 178
BstMWI GCNNNNNNNGC 1 cut(s) 182
BtsCI GGATG 1 cut(s) 119
CfoI GCGC 1 cut(s) 178
Csp6I GTAC 1 cut(s) 107
CviAII CATG 2 cut(s) 99, 110
CviQI GTAC 1 cut(s) 107
DdeI CTNAG 1 cut(s) 145
FaeI CATG 2 cut(s) 102, 113
FaiI YATR 4 cut(s) 100, 111, 168, 170
FatI CATG 2 cut(s) 98, 109
FauNDI CATATG 1 cut(s) 168
FokI GGATG 1 cut(s) 106
FspBI CTAG 1 cut(s) 182
GlaI GCGC 1 cut(s) 177
GsaI CCCAGC 1 cut(s) 197
HaeII RGCGCY 1 cut(s) 179
HhaI GCGC 1 cut(s) 178
Hin1II CATG 2 cut(s) 102, 113
Hin6I GCGC 1 cut(s) 176
HinP1I GCGC 1 cut(s) 176
HinfI GANTC 1 cut(s) 126
HphI GGTGA 1 cut(s) 147
Hpy188III TCNNGA 2 cut(s) 123, 133
HpyAV CCTTC 2 cut(s) 50, 162
HpyF10VI GCNNNNNNNGC 1 cut(s) 182
HpyF3I CTNAG 1 cut(s) 145
Hsp92II CATG 2 cut(s) 102, 113
HspAI GCGC 1 cut(s) 176
LpnPI CCDG 4 cut(s) 23, 96, 171, 179
MaeI CTAG 1 cut(s) 182
MboII GAAGA 1 cut(s) 121
MluCI AATT 1 cut(s) 51
MnlI CCTC 5 cut(s) 34, 40, 126, 129, 165
MseI TTAA 3 cut(s) 69, 90, 205
MwoI GCNNNNNNNGC 1 cut(s) 182
NdeI CATATG 1 cut(s) 168
NlaIII CATG 2 cut(s) 102, 113
PfeI GAWTC 1 cut(s) 126
PspFI CCCAGC 1 cut(s) 193
RsaI GTAC 1 cut(s) 108
RsaNI GTAC 1 cut(s) 107
SaqAI TTAA 3 cut(s) 69, 90, 205
SetI ASST 4 cut(s) 45, 85, 97, 118
Sse9I AATT 1 cut(s) 51
SsiI CCGC 1 cut(s) 139
SspMI CTAG 1 cut(s) 182
TaqI TCGA 1 cut(s) 45
TasI AATT 1 cut(s) 51
TatI WGTACW 1 cut(s) 106
TfiI GAWTC 1 cut(s) 126
Tru1I TTAA 3 cut(s) 69, 90, 205
Tru9I TTAA 3 cut(s) 69, 90, 205
TspDTI ATGAA 3 cut(s) 17, 87, 126
XspI CTAG 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.