Rh2BG182800

CDPK-related kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
16269465 .. 16270714
1250 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG182800.1

Sequence Viewer

Length: 615 bp
ATGACAGCTGCACAAGCGTTAAGTCATCCCTGGCTTAAAAATTATAGCACTGTTAAAATTCCTCTGGACATATTAATATTCAAGCTCATGAAGATTTATATGCGCTCATCACCTCTCCGCAAAACTGCTTTAAGGGCTCTTTCCAAGACATTGACTGTTGATGAGCTTTGCTATTTGAAGGAGCAGTTTGCGCTTTTAGAACCAAACAAAAATGGCACAATAAGCTTAGAAAACATCAAAACGGCCTTGATGAAAAATGCAACTGATGCAATGAAGGAGGCACGAATTGCTGATTTTCTAGCATCGCTTAATGCATTGCAATACAGAAGGATGGATTTTGAGGAATTTTGTACAGCTGCACTAAGTGTCCACCAACTTGAGGCTCTGGACCGTTGGGAGCAACATGCTCGTTGTGCATATGAACTTTTTGACAAGGAAGGCAACAGGGCTATTGTCATTGAGGAACTGGCTTCGGAACTTGGTCTTGGCCCTTCTGTCCCTGTTCATGCGGTTCTTCATGATTGGATTAGGCACACCGACGGGAAGCTGAGTTTCCTTGGATTTGTGAAATTGTTGCATGGCGTATCTAGCCGGGTTGTTGCAAAAGCTCAATGA

Protein Analysis

204

Amino Acids

23.05

Weight (kDa)

8.72

Isoelectric Point (pI)

35.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 118, 509
AcsI RAATTY 2 cut(s) 57, 344
AdeI CACNNNGTG 1 cut(s) 365
AfaI GTAC 1 cut(s) 352
AfiI CCNNNNNNNGG 1 cut(s) 379
AgsI TTSAA 2 cut(s) 82, 178
AjnI CCWGG 1 cut(s) 29
AjuI GAANNNNNNNTTGG 2 cut(s) 468, 500
AluBI AGCT 7 cut(s) 8, 85, 166, 225, 356, 547, 608
AluI AGCT 7 cut(s) 8, 85, 166, 225, 356, 547, 608
AoxI GGCC 2 cut(s) 243, 487
ApeKI GCWGC 2 cut(s) 8, 356
ApoI RAATTY 2 cut(s) 57, 344
AseI ATTAAT 1 cut(s) 74
AspLEI GCGC 2 cut(s) 105, 193
AspS9I GGNCC 2 cut(s) 388, 488
AsuC2I CCSGG 1 cut(s) 593
AsuHPI GGTGA 1 cut(s) 102
AvaII GGWCC 1 cut(s) 388
BanII GRGCYC 1 cut(s) 139
BbvI GCAGC 1 cut(s) 343
BccI CCATC 1 cut(s) 325
BceAI ACGGC 1 cut(s) 258
BcgI CGANNNNNNTGC 2 cut(s) 389, 423
BciT130I CCWGG 1 cut(s) 31
BcnI CCSGG 1 cut(s) 593
BfaI CTAG 2 cut(s) 299, 588
BisI GCNGC 2 cut(s) 9, 357
BlsI GCNGC 2 cut(s) 10, 358
Bme1390I CCNGG 2 cut(s) 31, 593
Bme18I GGWCC 1 cut(s) 388
BmgT120I GGNCC 2 cut(s) 388, 488
BmrFI CCNGG 2 cut(s) 31, 593
BmsI GCATC 2 cut(s) 256, 311
BpuEI CTTGAG 1 cut(s) 398
BpuMI CCSGG 1 cut(s) 593
BsaJI CCNNGG 2 cut(s) 29, 556
Bsc4I CCNNNNNNNGG 1 cut(s) 379
Bse1I ACTGG 1 cut(s) 471
Bse3DI GCAATG 2 cut(s) 276, 314
BseBI CCWGG 1 cut(s) 31
BseDI CCNNGG 2 cut(s) 29, 556
BseGI GGATG 2 cut(s) 25, 336
BseLI CCNNNNNNNGG 1 cut(s) 379
BseMI GCAATG 2 cut(s) 276, 314
BseMII CTCAG 1 cut(s) 539
BseNI ACTGG 1 cut(s) 471
BseXI GCAGC 1 cut(s) 343
BsgI GTGCAG 1 cut(s) 342
BshFI GGCC 2 cut(s) 245, 489
BsiSI CCGG 1 cut(s) 592
BslFI GGGAC 1 cut(s) 482
BslI CCNNNNNNNGG 1 cut(s) 379
BsmFI GGGAC 1 cut(s) 482
BsnI GGCC 2 cut(s) 245, 489
Bsp1286I GDGCHC 1 cut(s) 139
Bsp1407I TGTACA 1 cut(s) 350
BspACI CCGC 2 cut(s) 118, 509
BspANI GGCC 2 cut(s) 245, 489
BspCNI CTCAG 1 cut(s) 540
BspHI TCATGA 2 cut(s) 87, 517
BsrDI GCAATG 2 cut(s) 276, 314
BsrGI TGTACA 1 cut(s) 350
BsrI ACTGG 1 cut(s) 471
BssECI CCNNGG 2 cut(s) 29, 556
BssT1I CCWWGG 1 cut(s) 556
Bst2UI CCWGG 1 cut(s) 31
Bst4CI ACNGT 3 cut(s) 52, 157, 392
BstAPI GCANNNNNTGC 2 cut(s) 266, 287
BstAUI TGTACA 1 cut(s) 350
BstDEI CTNAG 3 cut(s) 226, 362, 548
BstF5I GGATG 2 cut(s) 25, 336
BstHHI GCGC 2 cut(s) 105, 193
BstMWI GCNNNNNNNGC 8 cut(s) 14, 134, 190, 222, 266, 287, 413, 588
BstNI CCWGG 1 cut(s) 31
BstNSI RCATGY 1 cut(s) 407
BstSCI CCNGG 2 cut(s) 29, 591
BstV1I GCAGC 1 cut(s) 343
BsuRI GGCC 2 cut(s) 245, 489
BtgZI GCGATG 1 cut(s) 288
BtsCI GGATG 2 cut(s) 25, 336
BtsIMutI CAGTG 1 cut(s) 48
CciI TCATGA 2 cut(s) 87, 517
CfoI GCGC 2 cut(s) 105, 193
Cfr13I GGNCC 2 cut(s) 388, 488
Csp6I GTAC 1 cut(s) 351
CviAII CATG 5 cut(s) 88, 404, 506, 518, 578
CviQI GTAC 1 cut(s) 351
DdeI CTNAG 3 cut(s) 226, 362, 548
DraIII CACNNNGTG 1 cut(s) 365
Eco130I CCWWGG 1 cut(s) 556
Eco24I GRGCYC 1 cut(s) 139
Eco47I GGWCC 1 cut(s) 388
EcoRII CCWGG 1 cut(s) 29
EcoT14I CCWWGG 1 cut(s) 556
EcoT22I ATGCAT 1 cut(s) 316
EcoT38I GRGCYC 1 cut(s) 139
ErhI CCWWGG 1 cut(s) 556
FaeI CATG 5 cut(s) 91, 407, 509, 521, 581
FaqI GGGAC 1 cut(s) 482
FatI CATG 5 cut(s) 87, 403, 505, 517, 577
FauNDI CATATG 1 cut(s) 418
Fnu4HI GCNGC 2 cut(s) 9, 357
FokI GGATG 2 cut(s) 12, 343
FriOI GRGCYC 1 cut(s) 139
Fsp4HI GCNGC 2 cut(s) 9, 357
FspBI CTAG 2 cut(s) 299, 588
GlaI GCGC 2 cut(s) 104, 192
GluI GCNGC 2 cut(s) 9, 357
HaeIII GGCC 2 cut(s) 245, 489
HapII CCGG 1 cut(s) 592
HhaI GCGC 2 cut(s) 105, 193
Hin1II CATG 5 cut(s) 91, 407, 509, 521, 581
Hin6I GCGC 2 cut(s) 103, 191
HinP1I GCGC 2 cut(s) 103, 191
HindIII AAGCTT 1 cut(s) 223
HpaII CCGG 1 cut(s) 592
HphI GGTGA 1 cut(s) 102
Hpy166II GTNNAC 1 cut(s) 370
Hpy188I TCNGA 1 cut(s) 475
Hpy188III TCNNGA 4 cut(s) 65, 88, 386, 518
Hpy8I GTNNAC 1 cut(s) 370
Hpy99I CGWCG 1 cut(s) 542
HpyAV CCTTC 5 cut(s) 172, 268, 321, 431, 501
HpyCH4III ACNGT 3 cut(s) 52, 157, 392
HpyCH4V TGCA 9 cut(s) 11, 260, 269, 314, 319, 359, 416, 577, 602
HpyF10VI GCNNNNNNNGC 8 cut(s) 14, 134, 190, 222, 266, 287, 413, 588
HpyF3I CTNAG 3 cut(s) 226, 362, 548
Hsp92II CATG 5 cut(s) 91, 407, 509, 521, 581
HspAI GCGC 2 cut(s) 103, 191
LmnI GCTCC 2 cut(s) 181, 397
LpnPI CCDG 8 cut(s) 16, 43, 50, 371, 430, 452, 513, 605
Lsp1109I GCAGC 1 cut(s) 343
LweI GCATC 2 cut(s) 256, 311
MaeI CTAG 2 cut(s) 299, 588
MboII GAAGA 2 cut(s) 103, 506
MhlI GDGCHC 1 cut(s) 139
MluCI AATT 5 cut(s) 40, 57, 285, 344, 569
MnlI CCTC 6 cut(s) 72, 123, 271, 334, 373, 454
Mph1103I ATGCAT 1 cut(s) 316
MseI TTAA 6 cut(s) 20, 36, 54, 74, 131, 309
MspA1I CMGCKG 2 cut(s) 8, 356
MspI CCGG 1 cut(s) 592
MspR9I CCNGG 2 cut(s) 31, 593
MvaI CCWGG 1 cut(s) 31
MwoI GCNNNNNNNGC 8 cut(s) 14, 134, 190, 222, 266, 287, 413, 588
NciI CCSGG 1 cut(s) 593
NdeI CATATG 1 cut(s) 418
NlaIII CATG 5 cut(s) 91, 407, 509, 521, 581
NsiI ATGCAT 1 cut(s) 316
NspI RCATGY 1 cut(s) 407
PagI TCATGA 2 cut(s) 87, 517
PkrI GCNGC 2 cut(s) 10, 358
PshBI ATTAAT 1 cut(s) 74
Psp6I CCWGG 1 cut(s) 29
PspGI CCWGG 1 cut(s) 29
PspPI GGNCC 2 cut(s) 388, 488
PvuII CAGCTG 2 cut(s) 8, 356
RsaI GTAC 1 cut(s) 352
RsaNI GTAC 1 cut(s) 351
SaqAI TTAA 6 cut(s) 20, 36, 54, 74, 131, 309
SatI GCNGC 2 cut(s) 9, 357
Sau96I GGNCC 2 cut(s) 388, 488
ScrFI CCNGG 2 cut(s) 31, 593
SduI GDGCHC 1 cut(s) 139
SetI ASST 8 cut(s) 10, 87, 115, 168, 227, 358, 549, 610
SfaNI GCATC 2 cut(s) 256, 311
SinI GGWCC 1 cut(s) 388
SmlI CTYRAG 1 cut(s) 377
SmoI CTYRAG 1 cut(s) 377
Sse9I AATT 5 cut(s) 40, 57, 285, 344, 569
SsiI CCGC 2 cut(s) 118, 509
SspI AATATT 1 cut(s) 78
SspMI CTAG 2 cut(s) 299, 588
StyD4I CCNGG 2 cut(s) 29, 591
StyI CCWWGG 1 cut(s) 556
TaaI ACNGT 3 cut(s) 52, 157, 392
TasI AATT 5 cut(s) 40, 57, 285, 344, 569
TatI WGTACW 1 cut(s) 350
Tru1I TTAA 6 cut(s) 20, 36, 54, 74, 131, 309
Tru9I TTAA 6 cut(s) 20, 36, 54, 74, 131, 309
TscAI CASTG 1 cut(s) 55
TseI GCWGC 2 cut(s) 8, 356
TspDTI ATGAA 6 cut(s) 104, 266, 287, 435, 494, 506
TspRI CASTG 1 cut(s) 55
VpaK11BI GGWCC 1 cut(s) 388
VspI ATTAAT 1 cut(s) 74
XapI RAATTY 2 cut(s) 57, 344
XceI RCATGY 1 cut(s) 407
XspI CTAG 2 cut(s) 299, 588
Zsp2I ATGCAT 1 cut(s) 316
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.