Rroxscaffold_2G00146300

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
84229442 .. 84233935
4494 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00146300.1

Sequence Viewer

Length: 156 bp
ATGGCCCACTCAATTGGCCTACCCCCAGATGAACACATTTTTGTCACACTCGTTCACTATCTTGGCCGTGCCCACTTGGTGAAGCAAATGGTAAAGAAAGATGTGACAGAGATGATGAGGGTTAGCTTTACGGCCCTTGATATGGGAAGCTTATAA

Protein Analysis

51

Amino Acids

5.75

Weight (kDa)

6.9

Isoelectric Point (pI)

32.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 154
AcoI YGGCCR 1 cut(s) 64
AdeI CACNNNGTG 1 cut(s) 79
AfiI CCNNNNNNNGG 1 cut(s) 142
AluBI AGCT 2 cut(s) 126, 150
AluI AGCT 2 cut(s) 126, 150
AoxI GGCC 4 cut(s) 3, 16, 64, 132
AspS9I GGNCC 2 cut(s) 4, 133
AsuHPI GGTGA 1 cut(s) 91
BaeGI GKGCMC 1 cut(s) 73
BceAI ACGGC 2 cut(s) 51, 147
BmgT120I GGNCC 2 cut(s) 4, 133
Bsc4I CCNNNNNNNGG 1 cut(s) 142
BseLI CCNNNNNNNGG 1 cut(s) 142
BseSI GKGCMC 1 cut(s) 73
BshFI GGCC 4 cut(s) 5, 18, 66, 134
BslI CCNNNNNNNGG 1 cut(s) 142
BsnI GGCC 4 cut(s) 5, 18, 66, 134
Bsp1286I GDGCHC 1 cut(s) 73
BspANI GGCC 4 cut(s) 5, 18, 66, 134
BstSLI GKGCMC 1 cut(s) 73
BstXI CCANNNNNNTGG 1 cut(s) 14
BsuRI GGCC 4 cut(s) 5, 18, 66, 134
Cfr13I GGNCC 2 cut(s) 4, 133
CviJI RGCY 6 cut(s) 5, 18, 66, 126, 134, 150
CviKI_1 RGCY 6 cut(s) 5, 18, 66, 126, 134, 150
DraIII CACNNNGTG 1 cut(s) 79
EaeI YGGCCR 1 cut(s) 64
FaiI YATR 2 cut(s) 143, 154
HaeIII GGCC 4 cut(s) 5, 18, 66, 134
HindIII AAGCTT 1 cut(s) 148
HphI GGTGA 1 cut(s) 91
Hpy166II GTNNAC 1 cut(s) 55
Hpy8I GTNNAC 1 cut(s) 55
LpnPI CCDG 1 cut(s) 39
MaeIII GTNAC 2 cut(s) 43, 103
MfeI CAATTG 1 cut(s) 12
MhlI GDGCHC 1 cut(s) 73
MluCI AATT 1 cut(s) 12
MnlI CCTC 1 cut(s) 111
MunI CAATTG 1 cut(s) 12
NmuCI GTSAC 2 cut(s) 43, 103
PsiI TTATAA 1 cut(s) 154
PspPI GGNCC 2 cut(s) 4, 133
Sau96I GGNCC 2 cut(s) 4, 133
SduI GDGCHC 1 cut(s) 73
SetI ASST 2 cut(s) 128, 152
SgeI CNNG 6 cut(s) 38, 62, 74, 80, 88, 149
Sse9I AATT 1 cut(s) 12
TasI AATT 1 cut(s) 12
TseFI GTSAC 2 cut(s) 43, 103
Tsp45I GTSAC 2 cut(s) 43, 103
TspDTI ATGAA 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.